Selective androgen receptor modulator and methods of use thereof (2024)

U.S. patent number 10,662,148 [Application Number 15/887,076] was granted by the patent office on 2020-05-26 for selective androgen receptor modulator and methods of use thereof.This patent grant is currently assigned to UNIVERSITY OF TENNESSEE RESEARCH FOUNDATION. The grantee listed for this patent is University of Tennessee Research Foundation. Invention is credited to James T. Dalton, Duane D. Miller, Ramesh Narayanan, Thamarai Ponnusamy.

View All Diagrams

Selective androgen receptor modulator and methods of usethereof

Abstract

This invention provides substituted acylanilide compounds anduses thereof in treating a variety of diseases or conditions in asubject including, inter alia, a muscle wasting disease and/ordisorder such as duch*enne muscular dystrophy or Becker musculardystrophy.

Prior Publication Data

Related U.S. Patent Documents

References Cited [Referenced By]

U.S. Patent Documents

Foreign Patent Documents

Other References

Primary Examiner: Ramachandran; Umamaheswari
Attorney, Agent or Firm: Cohen; Mark S. Pearl Cohen ZedekLatzer Baratz LLP

Parent Case Text

CROSS-REFERENCE TO RELATED APPLICATIONS

This application is a Divisional of U.S. patent application Ser.No. 14/963,130, filed Dec. 8, 2015 and this application is aContinuation of U.S. patent application Ser. No. 15/398,672, filedJan. 4, 2017; which is a Continuation of U.S. patent applicationSer. No. 14/963,130, filed Dec. 8, 2015; which is aContinuation-in-Part of U.S. patent application Ser. No.14/062,748, filed Oct. 24, 2013; which is a Continuation-In-Part ofU.S. patent application Ser. No. 13/557,885, filed Jul. 25, 2012,now abandoned; which is a Continuation-In-Part of U.S. patentapplication Ser. No. 13/082,830, filed Apr. 8, 2011, now abandoned;which is a Continuation-In-Part of U.S. patent application Ser. No.11/785,064, now U.S. Pat. No. 8,853,266, filed Apr. 13, 2007; whichis a Continuation-In-Part of U.S. patent application Ser. No.11/634,380, filed Dec. 6, 2006, now abandoned; which is aContinuation-In-Part Application of U.S. patent application Ser.No. 11/505,499, filed on Aug. 17, 2006, now U.S. Pat. No.7,645,898, and of U.S. patent application Ser. No. 11/505,363,filed Aug. 17, 2006, now abandoned; which are Continuation-In-PartApplications of U.S. patent application Ser. No. 11/355,187, filedFeb. 16, 2006, now U.S. Pat. No. 7,919,647; which is aContinuation-In-Part of U.S. patent application Ser. No.11/220,414, filed Sep. 7, 2005, now U.S. Pat. No. 7,855,229; whichis a Continuation-In-Part of U.S. patent application Ser. No.11/146,427, filed Jun. 7, 2005, now U.S. Pat. No. 7,622,503; whichis a Continuation-In-Part of U.S. patent application Ser. No.10/863,524, filed Jun. 9, 2004, which is now abandoned; and isContinuation-In-Part Application of U.S. patent application Ser.No. 10/861,923, filed Jun. 7, 2004, now abandoned, all of which areincorporated herein by reference in their entirety.

Claims

What is claimed is:

1. A method of treating, reducing the severity, reducing theincidence, or reducing cardiovascular failure in a subjectsuffering from duch*enne muscular dystrophy, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III): ##STR00070## or its pharmaceutically acceptable salt.

2. The method of claim 1, wherein said method further increases thephysical function of said subject.

3. The method of claim 1, wherein said method further increases thequality of life of said subject.

4. The method of claim 1, wherein said method increases thesurvival of said subject.

5. The method of claim 1, wherein said method further delays onsetor improves symptoms of respiratory function.

Description

FIELD OF THE INVENTION

This invention provides substituted acylanilide compounds and usesthereof in treating a variety of diseases or conditions in asubject, including, inter alia, a muscle wasting disease and/ordisorder such as muscular dystrophies including duch*enne musculardystrophy and Becker muscular dystrophy.

BACKGROUND OF THE INVENTION

Muscle wasting refers to the progressive loss of muscle mass and/orto the progressive weakening and degeneration of muscles, includingthe skeletal or voluntary muscles, which control movement, cardiacmuscles, which control the heart (cardiomyopathies), and smoothmuscles. Chronic muscle wasting is a chronic condition (i.e.persisting over a long period of time) characterized by progressiveloss of muscle mass, and weakening and degeneration of muscle.

The loss of muscle mass that occurs during muscle wasting can becharacterized by muscle protein degradation by catabolism. Proteincatabolism occurs because of an unusually high rate of proteindegradation, an unusually low rate of protein synthesis, or acombination of both. Muscle protein catabolism, whether caused by ahigh degree of protein degradation or a low degree of proteinsynthesis, leads to a decrease in muscle mass and to musclewasting.

Muscle wasting is associated with chronic, neurological, genetic orinfectious pathologies, diseases, illnesses or conditions. Theseinclude muscular dystrophies such as duch*enne muscular dystrophy,Becker muscular dystrophy, limb-girdle disease, and myotonicdystrophy; muscle atrophies such as post-polio muscle atrophy(PPMA); cachexias such as cardiac cachexia, AIDS cachexia andcancer cachexia; and malnutrition, leprosy, diabetes, renaldisease, chronic obstructive pulmonary disease (COPD), cancer, endstage renal failure, sarcopenia, emphysema, osteomalacia, HIVinfection, AIDS, and cardiomyopathy.

In addition, other circ*mstances and conditions are linked to andcan cause muscle wasting. These include chronic lower back pain,advanced age, central nervous system (CNS) injury, peripheral nerveinjury, spinal cord injury, chemical injury, central nervous system(CNS) damage, peripheral nerve damage, spinal cord damage, chemicaldamage, burns, disuse deconditioning that occurs when a limb isimmobilized, long term hospitalization due to illness or injury,and alcoholism.

An intact androgen receptor (AR) signaling pathway is crucial forappropriate development of skeletal muscles. Furthermore, an intactAR-signaling pathway increases lean muscle mass, muscle strengthand muscle protein synthesis.

Muscle wasting, if left unabated, can have dire healthconsequences. For example, the changes that occur during musclewasting can lead to a weakened physical state that is detrimentalto an individual's health, resulting in increased susceptibility tohone fracture and poor physical performance status. In addition,muscle wasting is a strong predictor of morbidity and mortality inpatients suffering from cachexia and AIDS.

duch*enne muscular dystrophy is the most common of nine musculardystrophies and occurs in 1/3500 to 1/5000 males around the world.duch*enne muscular dystrophy patients experience difficulty withwalking at 3-5 years of age, progressive worsening of symptoms, anddeath in the teens to 3.sup.rd decade. Discovered in the 1860's,little was known about the pathogenesis of duch*enne musculardystrophy until 1986 when the gene underlying this X-linkedautosomal recessive disease was cloned and characterized. The genewas named dystrophin (DMD) and found to be part of a sarcolemma(i.e. myocte plasma membrane) protein complex(dystrophin-glycoprotein complex) which connects the myofibril(muscle cell) cytoskeleton to the extracellular matrix, therebyprotecting the muscle cell membrane from physical trauma duringmuscle exertion and exercise. duch*enne muscular dystrophy ispredominantly a disease in males and is associated with a varietyof mutations of the DMD gene which leads to a wide variation ofdisease severities. Sarcolemma fragility produces progressivecalcium permeability, protease activation, oxidative stress, andinflammation which causes progressive replacement of muscle cellsby fibrous tissue and/or conversion to fat. Gross pathologyincludes weakness and degeneration of skeletal and voluntary musclewhich is exacerbated by high impact exercise, muscle contracturesthat worsen mobility if not corrected, and scoliosis. Althoughbraces and walkers provide some protection, declines in physicalfunction result in loss of ambulation during childhood leading towheelchair confinement, and eventually impaired cardiac(cardiomyopathy) or respiratory (diaphragm fibrosis) function leadsto death. Average life expectancy has improved (and rare cases ofmen living into their 4.sup.th or 5.sup.th decade) as a result ofbetter respiratory (glucocorticoids) and cardiac (ACE inhibitors,angiotensin receptor blockers, and beta-blockers) supportive care,but no disease-modifying therapeutics exist. Anabolics (steroidalandrogens, fa*g, etc.) to slow the rate of physical function declinehave been proposed and were shown to provide some benefit in smallclinical trials, but no nonsteroidal or tissue-selective androgenreceptor modulator (SARM) has entered clinical testing for duch*ennemuscular dystrophy. The loss of gene function etiology hasattracted great interest toward gene therapy approaches to treatthe disease; however, such treatments have not completely reversedthe phenotype and suffer from difficulties inherent in nucleotidepolymer based therapeutics which are exacerbated by the large andcomplex nature of the dystrophin gene. The above suggests thatother therapeutic targets are urgently needed. Consequently, thereis increasing interest in further improving the quality of life andlength of life via symptom directed supportive care. Arylpropanamide SARMs have been shown to increase global anabolic tonein multiple clinical trials through increases in muscle mass (leanbody mass by DEXA) and physical function (e.g., leg press, gripstrength, stair climb power) suggesting that they may havetherapeutic effects on dystrophic skeletal and specificallydiaphragm muscle, cardiac, and smooth muscle, or may delay onset orimprove symptoms of loss of mobility/autonomy, cardiomyopathy, orrespiratory insufficiency in duch*enne muscular dystrophy or Beckermuscular dystrophy and other muscular dystrophy patients.

Becker muscular dystrophy is a rarer and milder variation ofduch*enne muscular dystrophy caused by DMD mutants that do notcompletely abrogate dystrophin glycoprotein complex function inmales or more commonly it is observed in some female carriers(duch*enne muscular dystrophy is often asymptomatic in females).Becker muscular dystrophy has a phenotype with less functionalimpairment and longer life expectancy, but clinicalcardiomyopathies and respiratory insufficiencies must be closelymonitored.

Interest in drug design for duch*enne muscular dystrophy washampered by the lack of good models of this disease, howeverseveral in vivo disease models now exist. These include thedystrophin gene deletion in mice (mdx mice; denoted by DMD (-/-))which presents a phenotype representative of the early stages ofthe disease in humans however, is not progressive in symptomologyand much less severe in the later stages of the disease.Double-knockout (knock-down) mice lacking dystrophin (DMD) andutrophin (MN, a protein that can partially compensate for lack ofdystrophin) (i.e., DMD (-/-) UTRN (-/-)) present a phenotype morerepresentative of the natural history of duch*enne musculardystrophy in humans including progressive worsening of symptoms,loss of ambulation at 12 weeks, and early death by .about.20 weeks.[A severe phenotype can also be derived from the mdx model byforced treadmill running.] Golden retriever muscular dystrophy isanother disease model that matches the human phenotype in, someways but suffers from a high level of interindividual variationeven among littermates, complicating the interpretation of results.Although the pathogenesis of other muscular dystrophies is notrelated to duch*enne and Becker muscular dystrophies, the phenotypestherein suggest that activity in the mdx and double knockout modelsmay be indicative of therapeutic efficacies in those disease statesas well.

While there are many treatments and therapies for these conditions,none are ideal. Since the androgen receptor (AR) signaling pathwayhas been shown to increase lean muscle mass, muscle strength andmuscle protein synthesis, and since hypogonadism accompanies theseconditions, molecules targeting the AR signaling pathway may beuseful in treating these diseases and/or conditions.

SUMMARY OF THE INVENTION

The present invention is directed to a method of treating, reducingthe severity, reducing the incidence, delaying the onset, orreducing the pathogenesis of duch*enne muscular dystrophy in asubject in need thereof, comprising the step of administering tosaid subject a selective androgen receptor modulator (SARM)compound represented by the structure of formula S-(III):

##STR00001##

or its isomer, pharmaceutically acceptable salt, hydrate, N-oxide,or any combination thereof.

In one embodiment, the administering of the present inventioncomprises administering a pharmaceutical composition comprisingsaid compound and/or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof; and apharmaceutically acceptable carrier.

In one embodiment, the present invention further increases thephysical function of said subject.

In one embodiment, the present invention further increases thequality of life of said subject.

In one embodiment, the present invention increases the survival ofsaid subject.

In one embodiment, the present invention delays onset or improvessymptoms of cardiomyopathy and/or respiratory function.

In one embodiment, the present invention provides a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of myotonic dystrophy,limb-girdle muscular dystrophy, facioscapulhumeral musculardystrophy, congenital muscular dystrophy, oculopharyngeal musculardystrophy, distal muscular dystrophy, or Emery-Dreifuss musculardystrophy in a subject in need thereof, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00002##

or its isomer, pharmaceutically acceptable salt, hydrate, N-oxide,or any combination thereof.

In one embodiment, the administering comprises administering apharmaceutical composition comprising said compound and/or itsisomer, pharmaceutically acceptable salt, hydrate, N-oxide, or anycombination thereof; and a pharmaceutically acceptable carrier.

In one embodiment, the method further increases the physicalfunction of said subject.

In one embodiment, the method further increases the quality of lifeof said subject.

In one embodiment, this invention is directed to a method ofincreasing the physical function of a subject suffering fromduch*enne muscular dystrophy, comprising the step of administeringto said subject a selective androgen receptor modulator (SARM)compound in represented by the structure of formula S-(III):

##STR00003## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method ofincreasing the quality of life of a subject suffering from duch*ennemuscular dystrophy, comprising the step of administering to saidsubject a selective androgen receptor modulator (SARM) compoundrepresented by the structure of formula S-(III):

##STR00004## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method ofincreasing the survival of a subject suffering from duch*ennemuscular Dystrophy, comprising the step of administering to saidsubject a selective androgen receptor modulator (SARM) compoundrepresented by the structure of formula S-(III):

##STR00005## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, the present invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of cardiomyopathy in asubject suffering from duch*enne muscular dystrophy, comprising thestep of administering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00006## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, the present invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of respiratory failure in asubject suffering from duch*enne muscular dystrophy, comprising thestep of administering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00007## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of Becker musculardystrophy or myotonic dystrophy in a subject in need thereof,comprising the step of administering to said subject a selectiveandrogen receptor modulator (SARM) compound represented by thestructure of formula S-(III):

##STR00008##

or its isomer, pharmaceutically acceptable salt, hydrate, N-oxide,or any combination thereof.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiovascular disease in a humansubject suffering from duch*enne muscular dystrophy comprising thestep of administering an effective amount of a compound of formulaS-(III) or its isomer, pharmaceutically acceptable salt,pharmaceutical product, crystal, N-oxide, hydrate or anycombination thereof to said subject.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiovascular disease in a humansubject suffering from Becker muscular dystrophy comprising thestep of administering an effective amount of a compound of formulaS-(III) or its isomer, pharmaceutically acceptable salt,pharmaceutical product, crystal, N-oxide, hydrate or anycombination thereof to said subject.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiovascular disease in a humansubject suffering from myotonic dystrophy comprising the step ofadministering an effective amount of a compound of formula S-(III)or its isomer, pharmaceutically acceptable salt, pharmaceuticalproduct, crystal, N-oxide, hydrate or any combination thereof tosaid subject.

In one embodiment, the present invention provides a method ofreducing a fat mass in a subject suffering from duch*enne musculardystrophy comprising the step of administering an effective amountof a compound of formula S-(III) or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject.

In one embodiment, the present invention provides a method ofreducing a fat mass in a subject suffering from Becker musculardystrophy comprising the step of administering an effective amountof a compound of formula S-(III) or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject.

In one embodiment, the present invention provides a method ofreducing a fat mass in a subject suffering from myotonic dystrophycomprising the step of administering an effective amount of acompound of formula S-(III) or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject.

In one embodiment, the present invention provides a method ofincreasing a lean mass in a subject suffering from duch*ennemuscular dystrophy comprising the step of administering aneffective amount of a compound of formula S-(III) or its isomer,pharmaceutically acceptable salt, pharmaceutical product, crystal,N-oxide, hydrate or any combination thereof to the subject.

In one embodiment, the present invention provides a method ofincreasing a lean mass in a subject suffering from Becker musculardystrophy comprising the step of administering an effective amountof a compound of formula S-(III) or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject.

In one embodiment, the present invention provides a method ofincreasing a lean mass in a subject suffering from myotonicdystrophy comprising the step of administering an effective amountof a compound of formula S-(III) or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject.

In one embodiment, the present invention provides a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of myotonic dystrophy,limb-girdle muscular dystrophy, facioscapulhumeral musculardystrophy, congenital muscular dystrophy, oculopharyngeal musculardystrophy, distal muscular dystrophy, or Emery Dreifuss musculardystrophy in a subject in need thereof, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00009##

or its isomer, pharmaceutically acceptable salt, hydrate, N-oxide,or any combination thereof.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG. 1: Organ weights from intact rats treated with a compound offormula S-(III) presented as a percentage of intact control. *P-value <0.05 versus intact controls.

FIG. 2: Organ weights from castrated, compound of formulaS-(III)-treated rats presented as a percentage of intact control. *P-value <0.05 versus intact controls.

FIG. 3: Organ weight maintenance dose-response curves for compoundof formula S-(III) in castrated rats compared to oxandrolone.

FIG. 4: Organ weight maintenance dose-response curves for compoundof formula S-(III) in castrated rats. E.sub.max and ED.sub.50values for the levator ani (closed triangles), prostate (opencircles), and seminal vesicles (closed squares) were obtained bynonlinear regression analysis using the sigmoid E.sub.max model inWinNonlin.RTM..

FIG. 5: Organ weights from castrated rats after delayed dosing ofcompound of formula S-(III) presented as a percentage of intactcontrol. * P-value <0.05 versus intact controls.

FIG. 6: Organ weight regrowth dose-response curves followingdelayed dosing of compound of formula S-(III) in castrated rats.E.sub.max and ED.sub.50 values for the levator ani (closedtriangles), prostate (open circles), and seminal vesicles (closedsquares) were obtained by nonlinear regression analysis using thesigmoid E.sub.max model in WinNonlin.RTM..

FIG. 7: Cholesterol reduction by compound of formula S-(III) inrats.

FIG. 8: Total lean mass increase of all subjects with 0.1 mg, 0.3mg, 1 mg, and 3 mg dose of Compound S-(III).

FIG. 9: Total fat mass change of all subjects with 01 mg, 0.3 nag,1 mg, and 3 mg dose of Compound S-(III).

FIG. 10: Insulin resistance results (including insulin, glucose andHOMA-IR levels) of Avandia.RTM., glipizide and compound of formulaS-(III).

FIG. 11: Improvement of soleus strength in ovariectomized (OVX)rats treated with compound of formula S-(III).

FIGS. 12A-12D: Trabecular bone mineral density determined by pQCTanalysis of the distal femur 12A. Rat distal femur representativereconstructions 12B. BV/TV analysis of the distal femur 12C.Trabecular number of the distal femur 12D.

FIG. 13: plots circulating levels of compound of formula S-(III) inplasma in nude and female dogs.

FIGS. 14A-14C: depict recruitment of AR in response to DHT or SARM.FIG. 14A is a Ven diagram showing the number of promoterssignificantly recruiting AR over vehicle in response to DHT, SARMor DHT and SARM. FIG. 14B illustrates classification of genesassayed with known function (1023) whose promoters were occupied byAR in response to DHT (open bars), SAM (filled bars) or promoterscommon to DHT SARM (hatched bars). FIG. 14C depicts computationalidentification of androgen responsive AR direct target genepromoters in response to DHT, SARM or DHT and SARM. Human andorthologous mouse sequences determined from the AR promoter arrayexperiment were searched for the presence of ARE.

FIGS. 15A-15D: depict recruitment of SRC-1 in response to DHT orSARM. FIG. 15A illustrates recruitment to PSA enhancer as measuredby realtime quantitative PCR. Values are reported as the ratio oftarget detected in the immunoprecipitated (IP) DNA pool to targetdetected in the total input DNA pool. Open bars are vehicletreated, filled bars are DHT treated and hatched bars are SARMtreated, FIG. 15B depicts is a Ven diagram showing the number ofpromoters significantly recruiting SRC-1 over vehicle in responseto DHT or SARM or DHT and SARM. FIG. 15C depicts classification ofgenes assayed with known function (1015) whose promoters wereoccupied by SRC-1 in response to DHT (open bars), SARM (filledbars) or promoters common to DHT and SARM (hatched bars). FIG. 15Dillustrates computational identification of androgen responsiveelements in SRC-1 target gene promoters in response to DHT, SARMDHT and SARM. Human and orthologous mouse sequences determined fromthe SRC-1 promoter array experiment were searched for the presenceof ARE.

FIGS. 16A-16B: Validation of promoter array. FIG. 16A. Validationof AR recruitment to various promoters. LNCaP cells were maintainedin 1% csFBS for 6 days to reduce the basal transcription factorrecruitment and were treated with vehicle (open bars), 100 nM DHT(filled bars) SARM (hatched bars) for 60 min. ChIP assay wasperformed with AR antibody and recruitment to various promotersshowing significance from the array were measured using realtimertPCR primers and probes (Table 16). Values are reported as theratio of target DNA detected in the IP DNA pool to target DNAdetected in the total input DNA pool. The experiments wereperformed in triplicate. FIG. 16B. Measurement of genetranscription of promoters to which AR was recruited. Genetranscription was measured by treating LNCaP cells maintained in 1%csFBS (STAT5B, SHC-1, GAS7, APIG1, AXIN1, ATM and MSX-1) or fullserum (NFkB1E). The cells were treated with vehicle (open bars),DHT (filled bars) or SARM (hatched bars). RNA was extracted andrealtime rtPCR was performed using TaqMan primers and probe andnormalized to 18S, The experiments were performed in triplicate.Cells were treated for 24 hrs. * indicate significance at P<0.05from vehicle treated samples. IP-Immunoprecipitation;ChIP-Chromatin Immunoprecipitation.

FIG. 17: Change from baseline to Day 113/EOS in stair climb power:MITT population.

EOS=end of study; MITT=modified intent-to-treat.

FIG. 18: Change from baseline to Day 113/EOS in stair climb time:MITT population. EOS=end of study; MITT=modifiedintent-to-treat.

FIG. 19: Correlation between stair climb power and QoL per FAACTquestionnaire in NSCLC patients.

FIGS. 20A-20B depict Study A--Platinum+Taxane plus add on Lean bodymass efficacy endpoint. FIG. 20A: MMRM analysis through Day 84visit; FIG. 20B: MMRM analysis through Day 147 visit.

FIGS. 21A-21B depict Study A--Platinum+Taxane plus add on bodyweight efficacy endpoints. FIG. 21A: MMRM analysis through Day 84visit; FIG. 21B: MMRM analysis through Day 147 visit.

FIGS. 22A-22B depict Study A--Platinum+Taxane plus add on Stairclimb test (% power change) efficacy endpoints. FIG. 22A: MMRManalysis through Day 84 visit; FIG. 22B: MMRM analysis through Day147 visit.

FIGS. 23A-23B depict Study B--Platinum+nontaxane plus add on leanbody mass efficacy endpoint. FIG. 23A: MMRM analysis through Day 84visit; FIG. 23B: MMRM analysis through Day 147 visit.

FIGS. 24A-24B depict Study B--Platinum+nonaxane plus add on bodyweight endpoint. FIG. 24A: MMRM analysis through Day 84 visit; FIG.24B: MMRM analysis through Day 147 visit.

FIGS. 25A-25B depict Study B--Platinum+nonaxane plus add on stairclimb test (% power change) efficacy endpoint. FIG. 25A: MMRManalysis through Day 84 visit; FIG. 25B: MMRM analysis through Day147 visit.

FIG. 26 shows plasma concentrations of compound III were lower inStudy B LBM nonresponders.

FIG. 27 shows LBM nonresponders who reported nausea and vomitinghad lower Compound III levels in Study B. Compound S-(III) levelswere similar in LBM responders and non-responders who did NOTreport nausea and vomiting

FIG. 28 shows Study B Platinum+Nontaxane subjects had lowerhemoglobin levels. WHO definition of anemia Men .ltoreq.13 g/dL;Women .ltoreq.12 g/dL.

FIG. 29 depicts LBM benefit not affected by hemoglobinconcentrations.

FIG. 30 shows physical function benefit of new muscle is associatedwith hemoglobin concentrations.

FIG. 31 depicts pooled survival analysis.

FIG. 32 shows Day 84 LBM response is associated with longersurvival landmark analyses.

FIG. 33 shows Day 42 LBM response is associated with longersurvival landmark analyses.

FIG. 34 depicts survival by arm and LBM response.

FIG. 35 depicts 10% SCP response by .gtoreq.1 kg LBM response inpost-hoc analyses.

FIG. 36 depicts 10% SCP response by ARM by .gtoreq.1 kg LBMresponse in post-hoc analyses.

FIGS. 37A-37D show that compound of formula S-(III) in the DMDsingle knockout or mdx mouse model (DMD (-/-) UTRN (+/+)), e.g.,increased body weight and lean mass of DMD knockout mice. FIG. 37Ashows the effects of S-(III) on body weight in DMD (-/-) UTRN (+/+)mice. FIG. 37B shows the effects of S-(III) on fat mass in DMD(-/-) UTRN (+/+) mice. FIG. 37C shows the effects of S-(III) onlean [muscle] mass in DMD (-/-) UTRN (+/+) mice. FIG. 37D shows theeffects of S-(III) on grip strength in DMD (-/-) UTRN (+/+)mice.

FIGS. 38A-38C show the effects of `SARMs` in the double knock-outmouse model. FIGS. 38A-38C show that compounds of formulas S-(III),S-(IV), and S-(V) (labeled as `SARMs` because the data shown iscumulative across groups 2, 3 and 4 (see Example 18)) delayed thedeterioration of body weight, lean mass, and grip strength of DMD(-/-) UTRN (-/-) double knockout mice. FIG. 38A shows the effectsof `SARMs` on the body weight of DMD (-/-) UTRN (-/-)) mice. FIG.38B shows the effects of `SARMs` on the lean mass of DMD (-/-) UTRN(-/-) mice. FIG. 38C shows the effects of `SARMs` on the gripstrength of DMD (-/-) UTRN (-/-) mice. N=6-9 in each group.

FIGS. 39A and 39B show that compounds of formulas S-(III) or S-(V)(combined data labeled as `SARM`) and S-(III), respectively,increased the survival by 50-70% in DMD (-/-) UTRN (-/-) doubleknockout mice. FIG. 39A shows cumulative data whereas FIG. 39Bshows data from mice from the same litter (each group of two barsrepresents one litter). Despite similar characteristics at birth,mice treated with `SARM` or S-(III), respectively, exhibitedincreased survival than mice treated with vehicle.

FIGS. 40A and 40B allow the comparison of the castrated mdx mice tointact control mdx mice in terms of body weight. FIG. 40A depictsthe effect of S-(III) on body weight of intact DMD (-/-) UTRN (+/+)mice whereas FIG. 40B depicts the effects in castrated mdxmice.

FIGS. 41A and 41B allow the comparison of the castrated mdx mice tointact control mdx mice in terms of lean mass. FIG. 41A depicts theeffect of S-(III) on lean mass of intact DMD (-/-) UTRN (+/+) micewhereas FIG. 41B depicts the effects in castrated mdx mice.

DETAILED DESCRIPTION OF THE PRESENT INVENTION

In the following detailed description, numerous specific detailsare set forth in order to provide a thorough understanding of theinvention. However, it will be understood by those skilled in theart that the present invention may be practiced without thesespecific details. In other instances, well-known methods,procedures, and components have not been described in detail so asnot to obscure the present invention.

In one embodiment, this invention provides methods of treating,suppressing, inhibiting, reducing the severity of, reducing theincidence of reducing the pathogenesis of or delaying onset of,inter alia: a) muscle wasting in patients with cancer, wherein thepatients are subjected to cancer therapy; b) muscle wasting inpatients with non-small cell lung cancer (NSCLC), wherein thepatients are subjected to cancer therapy; c) muscle wasting inpatients with non-small cell lung cancer (NSCLC), wherein thepatients are subjected to taxane therapy d) pre-cachexia or earlycachexia (preventing muscle wasting in a cancer patient), whereinthe patients are subjected to cancer therapy; e) treating loss ofphysical function due to cancer or cancer therapy (radiation,chemotherapy, surgery); f) increasing physical function of asubject, wherein the subject is subjected to cancer therapy; g)increasing physical function of a cancer patient, wherein thepatient is subjected to cancer therapy; h) increasing physicalfunction of a cancer patient, wherein said patient suffers fromnon-small cell lung cancer, colorectal cancer, non-Hodgkinlymphoma, chronic lymphocytic leukemia or breast cancer, and issubjected to cancer therapy; i) increasing physical function of acancer patient, wherein said patient suffers from non-small celllung cancer, and is subjected to taxane therapy treating,suppressing, inhibiting, reducing the severity of, reducing theincidence of reducing the pathogenesis of, or delaying onset oflung cancer in a patient, wherein the patient is subjected tocancer therapy; k) increasing survival, functional independence,and increasing quality of life of a subject suffering from cancer,and is subjected to cancer therapy; l) increasing survival,functional independence, and increasing quality of life of asubject suffering from non-small cell lung cancer, and is subjectedto taxane therapy; m) preventing or treating declines in quality oflife due to cancer or cancer therapy; and treating diseases,disorders or conditions related thereto; n) increasing lean bodymass of a cancer patient that is subjected to cancer therapy; o)increasing lean body mass of a cancer patient, wherein said patientsuffers from non-small cell lung cancer, and is subjected to taxanetherapy; via the administration of any SARM as herein described andoptionally other therapeutic agents, including but not limited tochemotherapeutic agents, or compositions comprising the same.

In another embodiment, the methods of this invention comprise thestep of administering to the subject a compound of formulaS-(III):

##STR00010## or is isomer, pharmaceutically acceptable salt,pharmaceutical product, hydrate, N-oxide, or any combinationthereof.

In another embodiment, the methods of this invention comprise thestep of administering to the subject a compound of formulaS-(III):

##STR00011## or its isomer, pharmaceutically acceptable salt,pharmaceutical product, hydrate, N-oxide, or any combinationthereof and a chemotherapeutic agent.

In another embodiment, the methods of this invention comprise thestep of administering to the subject a compound of formulaS-(III):

##STR00012## or its isomer, pharmaceutically acceptable salt,pharmaceutical product, hydrate, N-oxide, or any combinationthereof and a platinum and a taxane.

In another embodiment, the methods of this invention comprise thestep of administering to the subject a compound of formulaS-(III):

##STR00013## or its isomer, pharmaceutically acceptable salt,pharmaceutical product, hydrate, N-oxide, or any combinationthereof, and platinum and non-taxane chemotherapeutic agent.

In some embodiments, the invention provides compositions comprisingthe compound of formula S-(III) or use of the compound of formulaS-(III) for treating muscle wasting in a subject, wherein saidsubject has non-small cell lung cancer. In another embodiment, thesubject is subjected to cancer therapy. In another embodiment, thesubject is subjected to radiation therapy. In another embodiment,the compound is administered in combination with chemotherapeuticagent. In another embodiment, the compound is administered incombination with radiation therapy.

In one embodiment, this invention provides methods of treatmentusing a compound of formula S-(III) or composition comprising thesame, as herein described. In some embodiments, the compound offormula S-(III) or composition comprising the same is administeredin combination with other therapeutic agents. In some embodiments,the compound of formula S-(III) or composition comprising the sameis administered to a subject subjected to cancer therapy. In someembodiments, the compound of formula S-(III) or compositioncomprising the same is administered to a subject subjected toradiation therapy. In some embodiments, the compound of formulaS-(III) or composition comprising the same is administered incombination with a chemotherapeutic agent. In some embodiments, thecompound of formula S-(III) or composition comprising the same isadministered in combination with radiation therapy. In anotherembodiment, the compound of formula S-(III) or compositioncomprising the same is administered in combination with platinumand a taxane chemotherapeutic agents. In another embodiment, thecompound of formula S-(III) or composition comprising the same isadministered in combination with platinum and a non-taxanechemotherapeutic agents.

In some embodiments, the invention provides methods of treatment,wherein the compound is a selective androgen receptor modulator(SARM). In some embodiments, the invention provides methods of useof a SARM for the treatment of the indicated diseases, disorders orconditions, and includes use of compositions comprising thesame.

In one embodiment, the terms "treating" or "treatment" is disorderruminative treatment. The terms "reducing", "suppressing" and"inhibiting" have their commonly understood meaning of lessening ordecreasing, in another embodiment, or delaying, in anotherembodiment, or reducing, in another embodiment the incidence,severity or pathogenesis of a disease, disorder or condition. Insome embodiments, the term "treatment" refers to delayedprogression of prolonged remission of, reduced incidence of, oramelioration of symptoms associated with the disease, disorder orcondition. In one embodiment, the terms "treating" "reducing","suppressing" or "inhibiting" refer to a reduction in morbidity,mortality, or a combination thereof, in association with theindicated disease, disorder or condition. In one embodiment, theterm "progression" refers to an increasing in scope or severity,advancing, growing or becoming worse. The term "recurrence" means,in another embodiment, the return of a disease after a remission.In one embodiment, the methods of treatment of the invention reducethe severity of the disease, or in another embodiment, symptomsassociated with the disease, or in another embodiment, reduces thenumber of biomarkers expressed during disease.

In one embodiment, the term "treating" and its included aspects,refers to the administration to a subject with the indicateddisease, disorder or condition, or in some embodiments, to asubject predisposed to the indicated disease, disorder orcondition. The term "predisposed to" is to be considered to referto, inter alia, a genetic profile or familial relationship which isassociated with a trend or statistical increase in incidence,severity, etc. of the indicated disease. In some embodiments, theterm "predisposed to" is to be considered to refer to inter alia, alifestyle which is associated with increased risk of the indicateddisease. In some embodiments, the term "predisposed to" is to beconsidered to refer to inter alia, the presence of biomarkers whichare associated with the indicated disease, for example, in cancer,the term "predisposed to" the cancer may comprise the presence ofprecancerous precursors for the indicated cancer.

In some embodiments, the term "reducing the pathogenesis" is to beunderstood to encompass reducing tissue damage, or organ damageassociated with a particular disease, disorder or condition. Inanother embodiment, the term "reducing the pathogenesis" is to beunderstood to encompass reducing the incidence or severity of anassociated disease, disorder or condition, with that in question.In another embodiment, the term "reducing the pathogenesis" is tobe understood to encompass reducing the number of associateddiseases, disorders or conditions with the indicated, or symptomsassociated thereto.

The term "administering", in another embodiment, refers to bringinga subject in contact with a compound of the present invention.Administration can be accomplished in vitro, i.e. in a test tube,or in vivo, i.e. in cells or tissues of living organisms, forexample humans. In one embodiment, the present inventionencompasses administering the compounds of the present invention toa subject.

In one embodiment, this invention provides for the use of a SARMcompound or its prodrug, analog, isomer, metabolite, derivative,pharmaceutically acceptable salt, pharmaceutical product,polymorph, crystal, impurity, N-oxide, hydrate or any combinationthereof, represented by the structure of formula (I):

##STR00014## wherein X is O; Z is alkyl NO.sub.2, CN, COR, COOH orCONHR; Y is CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; Q is alkyl, halogen, N(R).sub.2, CN, NHCOCH.sub.3,NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH.sub.3,NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3, NHSO.sub.2R, OR, COR,OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-, trifluoroacetamido-,alkylamines, ether, alkyl, N-sulfonyl, O-sulfonyl, alkylsulfonyl,carbonyl, or a ketone; R.sub.1 is CH.sub.3, CH.sub.2F, CHF.sub.2,CF.sub.3, CH.sub.2CH.sub.3, or CF.sub.2CF.sub.3; T is OH, OR,--NHCOCH.sub.3, NHCOR or OC(O)R; wherein R is a C.sub.1-C.sub.4alkyl, aryl, phenyl, alkenyl, hydroxyl, a C.sub.1-C.sub.4haloalkyl, halogen, or haloalkenyl.

In one embodiment, Q is in the para position. In anotherembodiment, X is O, or in another embodiment, T is OH, or inanother embodiment, R is CH.sub.3, or in another embodiment, Z isNO.sub.2, or in another embodiment, Z is CN, or in anotherembodiment, Z is in the para position, or in another embodiment, Yis CF.sub.3, or in another embodiment, Y is in the meta position,or in another embodiment, Q is in the para position, or in anotherembodiment, Q is para alkyl, halogen, CN, N(R).sub.2, NHCOCH.sub.3,NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH.sub.3,NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3, NHSO.sub.2R, OR, COR,OCOR, OSO.sub.2R, SO.sub.2R or SR, or in another embodiment, anycombination thereof. In another embodiment Q is F. In anotherembodiment Q is CN.

In one embodiment the present invention provides for the use of aSARM compound or its prodrug, analog, isomer, metabolite,derivative, pharmaceutically acceptable salt, pharmaceuticalproduct, polymorph, crystal, impurity, N-oxide, hydrate or anycombination thereof, represented by a structure of formula (I):

##STR00015## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isalkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, F orSn(R).sub.3; Q is CN; T is OH, OR, --NHCOCH.sub.3, NHCOR or OC(O)R;R is alkyl, haloalkyl, dihaloalkyl, trihaloalkyl, CH.sub.2F,CHF.sub.2, CF.sub.3, CF.sub.2CF.sub.3, aryl, phenyl, halogen,alkenyl, haloalkenyl or OH; and R.sub.1 is CH.sub.3, CH.sub.2F,CHF.sub.2, CF.sub.3, CH.sub.2CH.sub.3, or CF.sub.2CF.sub.3.

In one embodiment, Q is in the para position. In anotherembodiment, X is O, or in another embodiment, T is OH, or inanother embodiment, R.sub.1 is CH.sub.3, or in another embodiment,Z is NO.sub.2 or in another embodiment, Z is CN, or in anotherembodiment, Z is in the para position, or in another embodiment, Yis CF.sub.3, or in another embodiment, Y is in the meta position,or in another embodiment, Q is in the para position, or in anotherembodiment, Q is para alkyl, halogen, N(R).sub.2, NHCOCH.sub.3,NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH.sub.3,NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3, NHSO.sub.2R, OR, COR,OCOR, OSO.sub.2R, SO.sub.2R or SR, or in another embodiment, anycombination thereof. In another embodiment Q is F. In anotherembodiment Q is CN.

In one embodiment, this invention provides for the use of aracemate SARM compound represented by the structure of formula(Ia):

##STR00016## wherein X is O; Z is NO.sub.2, CN, COR, COOH or CONHR;Y is alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; Q is alkyl, halogen, N(R).sub.2, CN, NHCOCH.sub.3,NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH.sub.3,NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3, NHSO.sub.2R, OR, COR,OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-, trifluoroacetamido-,alkylamines, ether, alkyl, N-sulfonyl, O-sulfonyl, alkylsulfonyl,carbonyl, or a ketone; R.sub.1 is CH.sub.3, CH.sub.2F, CHF.sub.2,CF.sub.3, CH.sub.2CH.sub.3, or CF.sub.2CF.sub.3; T is OH, OR,--NHCOCH.sub.3, NHCOR or OC(O)R;

wherein R is a C.sub.1-C.sub.4, alkyl, aryl, phenyl, alkenyl,hydroxyl, C.sub.1-C.sub.4 haloalkyl, halogen, or haloalkenyl.

In one embodiment, Q is in the para position. In anotherembodiment, X is O. In another embodiment, Q is in the paraposition and X is O. In another embodiment, Q is para alkyl,halogen, N(R).sub.2, CN, NHCOCH.sub.3, NHCOCF.sub.3, NHCOR,NHCONHR, NHCOOR, OCONHR, CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR,NHSO.sub.2CH.sub.3, NHSO.sub.2R, OR, COR, OCOR, OSO.sub.2R,SO.sub.2R or SR. In another embodiment Q is F. In anotherembodiment Q is CN. In another embodiment, R is an aryl, phenyl,hydroxyl, C.sub.1-C.sub.4 alkyl, C.sub.1-C.sub.4 haloalkyl,halogen, alkenyl or haloalkenyl.

In one embodiment the present invention provides for the use of aSARM compound or its prodrug, analog, isomer, metabolite,derivative, pharmaceutically acceptable salt, pharmaceuticalproduct, polymorph, crystal, impurity, N-oxide, hydrate or anycombination thereof, represented by the structure of formula(II):

##STR00017## wherein X is O; Z is a NO.sub.2, CN, COR, or CONHR; Yis an alkyl, I, F, CF.sub.3, alkyl, formyl, alkoxy, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl, halogen, N(R).sub.2,CN, NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR,CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3,NHSO.sub.3R, OR, COR, OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines, ether, alkyl, N-sulfonyl,O-sulfonyl, alkylsulfonyl, carbonyl, or a ketone.

In one embodiment, this invention provides for the use of a SARMcompound or its prodrug, analog, isomer, metabolite, derivative,pharmaceutically acceptable salt, pharmaceutical product,polymorph, crystal, impurity, N-oxide, hydrate or any combinationthereof, represented by the structure of formula (II):

##STR00018## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isan alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl, halogen, N(R).sub.2,CN, NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR,CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3,NHSO.sub.2R, OR, COR, OCOR, OSO.sub.3R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines, ether, alkyl, N-sulfonyl,O-sulfonyl, alkylsulfonyl, carbonyl, or a ketone.

In one embodiment, X is O, or in another embodiment, T is OH, or inanother embodiment, R.sub.1 is CH.sub.3, or in another embodiment,Z is NO.sub.2, or in another embodiment, Z is CN, or in anotherembodiment, Y is CF.sub.3, or in another embodiment, Q is alkyl, F,Cl, Br, I, N(R).sub.2, NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR,NHCOOR, OCONHR, CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR,NHSO.sub.2CH.sub.3, NHSO.sub.2R, OR, COR, OCOR, OSO.sub.2R,SO.sub.2R, SR, acetamido-, trifluoroacetamido-, alkylamines, ether,alkyl, N-sulfonyl, O-sulfonyl, alkylsulfonyl, carbonyl, or a ketoneor in another embodiment, any combination thereof. In anotherembodiment Q is F. In another embodiment Q is CN.

In another embodiment, the present invention provides for the useof a SARM represented by a structure of formula (II):

##STR00019##

wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y is CF.sub.3, analkyl, CH.sub.3, formyl, alkoxy, H, I, Br, Cl, F or Sn(R).sub.3; Ris an alkyl, aryl, phenyl, alkenyl, haloalkyl, haloalkenyl, halogenor OH; and Q is CN.

In one embodiment, the invention provides for the use of a compoundor its prodrug, analog, isomer, metabolite, derivativepharmaceutically acceptable salt, pharmaceutical product,polymorph, crystal, impurity, N-oxide, hydrate or any combinationthereof, represented by a structure of formula S-(III):

##STR00020##

In another embodiment, this invention provides for the use of aSARM compound or its prodrug, analog, isomer, metabolite,derivative, pharmaceutically acceptable salt, pharmaceuticalproduct, polymorph, crystal, impurity, N-oxide, hydrate or anycombination thereof, represented by a structure of formula(IV):

##STR00021##

wherein X is O; T is OH, OR, NHCOCH.sub.3, NHCOR or OC(O)R; Z isNO.sub.2, CN, COOH, COR, NHCOR or CONHR; Y is hydrogen, alkyl,CF.sub.3, formyl alkoxy, halogen, hydroxyalkyl or alkyl aldehyde; Ris alkyl, haloalkyl, dihaloalkyl trihaloalkyl, CH.sub.2F,CHF.sub.2, CF.sub.3, CF.sub.2CF.sub.3, aryl, phenyl, halogen,haloalkenyl, alkenyl or OH; R.sub.1 is CH.sub.3, CH.sub.2F,CHF.sub.2, CF.sub.3, CH.sub.2CH.sub.3, or CF.sub.2CF.sub.3; and Ais a group selected from:

##STR00022## wherein R.sub.2, R.sub.3, R.sub.4, R.sub.5, andR.sub.6 are independently is H, halogen, NO.sub.2, CN, NHCOR.sub.9,N(COR).sub.2, COR.sub.10, OR.sub.11, OSO.sub.2R.sub.12,SO.sub.2R.sub.13, NHSO.sub.2R.sub.12, SR.sub.14, an imide ring,alkyl or substituted alkyl with at least one substituent ofhalogen, CN, NH.sub.2, OH, alkoxy; or R.sub.2 and R.sub.3, R.sub.3and R.sub.4, R.sub.4 and R.sub.5, or R.sub.5 and R.sub.6 form,together with any of the ring atom(s) to which they are attached, acondensed 5 to 7 membered aliphatic or aromatic carbocyclic ring ora condensed 5 to 7 membered heterocyclic ring containing 1 to 3heteroatom(s) selected from N, O, S; or represented by structuresA, B or C:

##STR00023## R.sub.7 and R.sub.8 are independently H, halogen,alkyl or alkenyl; R.sub.9 and R.sub.10 are independently alkyl,alkenyl, haloalkyl, aminoalkyl, mono- or di-alkylaminoalkyl, aryl,N(R.sub.15).sub.2 or --OR.sub.16; R.sub.11 and R.sub.14independently H, alkyl, alkenyl, haloalkyl, aminoalkyl, mono- ordi-alkylaminoalkyl, aryl, --COR.sub.17; R.sub.12 and R.sub.13 areindependently alkyl or alkenyl, haloalkyl or aryl; R.sub.15 andR.sub.16 are independently H, alkyl, alkenyl, haloalkyl, aminoalkylor aryl; and R.sub.17 is alkyl, alkenyl, haloalkyl or aryl.

In one embodiment, according to this aspect of the invention, X isO, or in another embodiment, T is OH, or in another embodiment,R.sub.1 is CH.sub.3, or in another embodiment, Z is NO.sub.2, or inanother embodiment, Z is CN, or in another embodiment. R.sub.2,R.sub.3, R.sub.5, and R.sub.6 are hydrogens and R.sub.4 isNHCOCF.sub.3, or in another embodiment, R.sub.2, R.sub.3, R.sub.5,and R.sub.6 are hydrogens and R.sub.4 is CN, or in anotherembodiment, R.sub.2, R.sub.3, R.sub.5, and R.sub.6 are hydrogensand R.sub.4 is F, or in another embodiment, R.sub.2, R.sub.3,R.sub.5, and R.sub.6 are hydrogens, or in another embodiment, Z isin the para position, or in another embodiment, Y is in the metaposition, or in another embodiment, any combination thereof.

In another embodiment, this invention is directed to the use of acompound represented by the structure of formula (XX):

##STR00024## wherein X is O; R.sub.1 is CH.sub.3, CF.sub.3,CH.sub.2CH.sub.3, or CF.sub.2CF.sub.3; T is OH, OR, NHCOCH.sub.3,or NHCOR; wherein R is a C.sub.1-C.sub.4 alkyl, a C.sub.1-C.sub.4haloalkyl, aryl, phenyl, halogen, alkenyl, haloalkenyl, orhydroxyl; A is a 5 or 6 membered saturated, unsaturated or aromaticcarbocyclic or heterocyclic ring represented by the structure:

##STR00025## B is a 5 or 6 membered saturated, unsaturated oraromatic carbocyclic or heterocyclic ring represented by thestructure:

##STR00026## wherein A.sub.1-A.sub.11 are each C, CH, CH.sub.2, O,S, N, or NH; B.sub.1-B.sub.11 are each C, CH, CH.sub.2, O, S, N, orNH; Z is a hydrogen bond acceptor, alkyl. H, NO.sub.2, CN, COOH,COR, NHCOR or CONHR; Y is a lipid soluble group, hydrogen, alkyl,formyl, alkoxy, hydroxylalkyl, alkylaldehyde, CF.sub.3, F, I, Br,Cl, CN, C(R).sub.3 or Sn(R).sub.3; and Q.sub.1 and Q.sub.2 areindependently of each other H, alkyl, halogen, CN, N(R).sub.2,NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR,NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3, NHSO.sub.2R,OR, COR, OCOR, OSO.sub.2R, SO.sub.2R or SR; wherein R is aC.sub.1-C.sub.4 alkyl, a C.sub.1-C.sub.4 haloalkyl, aryl, phenyl,halogen, alkenyl, haloalkenyl, or hydroxyl. In one embodiment, thealkyl group is CH.sub.3.

The substitutents Z and Y of the structure of formula XX can be inany position of the five or 6 membered ring carrying thesesubstitutents (hereinafter "A ring"). Similarly, the substituentQ.sub.1 and/or Q.sub.2 can be in any position of the five or 6membered ring carrying this substitutent (hereinafter "B ring"). Itis understood that when any of the ring members A.sub.1-A.sub.11orB.sub.1-B.sub.11 are O or S, then these ring members areunsubstituted. It is further understood that when any of the ringmembers A.sub.1-A.sub.11 or B.sub.1-B.sub.11 are O or S, then thedotted line between O or S atoms and adjacent ring membersrepresents a single bond.

In one embodiment, the A ring of the structure of formula XXincludes any type of saturated or unsaturated carbocyclic ring. Inone embodiment, the A ring is a 6 membered saturated carbocyclicring, which may be unsubstituted, monosubstituted orpolysubstituted by any of the substitutents described hereinabove.In one embodiment, the A ring is a 5 membered saturated carbocyclicring, which may be unsubstituted, monosubstituted orpolysubstituted by any of the substitutents described hereinabove.In another embodiment, the A ring is a 6 membered carbocyclic ringcontaining one or more double bonds, which ring may beunsubstituted, monosubstituted or polysubstituted by any of thesubstitutents described hereinabove. In another embodiment, the Aring is a 5 membered carbocyclic ring containing one or more doublebonds, which ring may be unsubstituted, monosubstituted orpolysubstituted by any of the substitutents describedhereinabove.

In another embodiment, the A ring of the structure of formula XXincludes any type of saturated, unsaturated or aromaticheterocyclic ring. In another embodiment, the A ring is a 6membered saturated heterocyclic ring, which may be unsubstituted,monosubstituted or polysubstituted by any of the substituentsdescribed hereinabove. In another embodiment, the A ring is a 5membered saturated heterocyclic ring, which may be unsubstituted,monosubstituted or polysubstituted by any of the substituentsdescribed hereinabove. In another embodiment, the A ring is a 6membered heterocyclic ring containing one or more double bonds,which ring may be unsubstituted, monosubstituted or polysubstitutedby any of the substitutents described hereinabove. In anotherembodiment, the A ring is a 5 membered heterocyclic ring containingone or more double bonds, which ring may be unsubstituted,monosubstituted or polysubstituted by any of the substitutentsdescribed hereinabove. In another embodiment, the A ring is a 6membered heteroaromatic ring which may be unsubstituted,monosubstituted or polysubstituted by any of the substitutentsdescribed hereinabove. In another embodiment, the A ring is a 5membered heteroaromatic ring which may be unsubstituted,monosubstituted or polysubstituted by any of the substitutentsdescribed hereinabove.

Similarly, the B ring of the structure of formula XX includes anytype of saturated or unsaturated carbocyclic ring. In oneembodiment, the B ring is a 6 membered saturated carbocyclic ring,which may be unsubstituted, monosubstituted or polysubstituted byany of the substitutents described hereinabove. In one embodiment,the B ring is a 5 membered saturated carbocyclic ring, which may beunsubstituted, monosubstituted or polysubstituted by any of thesubstitutents described hereinabove. In another embodiment, the Bring is a 6 membered carbocyclic ring containing one or more doublebonds, which ring may be unsubstituted, monosubstituted orpolysubstituted by any of the substitutents described hereinabove.In another embodiment, the B ring is a 5 membered carbocyclic ringcontaining one or more double bonds, which ring may beunsubstituted, monosubstituted or polysubstituted by any of thesubstitutents described hereinabove.

In another embodiment, the B ring of the structure of formula XXincludes any type of saturated, unsaturated or aromaticheterocyclic ring. In another embodiment, the B ring is a 6membered saturated heterocyclic ring, which may be unsubstituted,monosubstituted or polysubstituted by any of the substitutentsdescribed hereinabove. In another embodiment, the B ring is a 5membered saturated heterocyclic ring, which may be unsubstituted,monosubstituted or polysubstituted by any of the substituentsdescribed hereinabove. In another embodiment, the B ring is a 6membered heterocyclic ring containing one or more double bonds,which ring may be unsubstituted, monosubstituted or polysubstitutedby any of the substitutents described hereinabove. In anotherembodiment, the B ring is a 5 membered heterocyclic ring containingone or more double bonds, which ring may be unsubstituted,monosubstituted or polysubstituted by any of the substitutentsdescribed hereinabove. In another embodiment, the B ring is a 6membered heteroaromatic ring which may be unsubstituted,monosubstituted or polysubstituted by any of the substituentsdescribed hereinabove. In another embodiment, the B ring is a 5membered heteroaromatic ring which may be unsubstituted,monosubstituted or polysubstituted by any of the substitutentsdescribed hereinabove.

Nonlimiting examples of suitable A rings and/or B rings arecarbocyclic rings such as cyclopentane, cyclopentene, cyclohexane,and cyclohexene rings, and heterocyclic rings such as pyran,dihydropyran, tetrahydropyran, pyrrole, dihydropyrrole,tetrahydropyrrole, pyrazine, dihydropyrazine, tetrahydropyrazine,pyrimidine, dihydropyrimidine, tetrahydropyrimidone, pyrazole,dihydropyrazole, tetrahydropyrazole, piperidine, piperazine,pyridine, dihydropyridine, tetrahydropyridine, morpholine,thiomorpholine, furan, dihydrofuran, tetrahydrofuran, thiophene,dihydrothiophene, tetrahydrothiophene, thiazole, imidazole,isoxazole, and the like.

An "alkyl" group refers, in one embodiment, to a saturatedaliphatic hydrocarbon, including straight-chain, branched-chain andcyclic alkyl groups. In one embodiment, the alkyl group has 1-12carbons. In another embodiment, the alkyl group has 1-7 carbons. Inanother embodiment, the alkyl group has 1-6 carbons. In anotherembodiment, the alkyl group has 1-4 carbons. The alkyl group may beunsubstituted or substituted by one or more groups selected fromhalogen, hydroxy, alkoxy carbonyl, amido, alkylamido, dialkylamido,nitro, amino, alkylamino, dialkylamino, carboxyl, thio andthioalkyl. In one embodiment, the alkyl group is CH.sub.3.

An "alkenyl" group refers, in another embodiment, to an unsaturatedhydrocarbon, including straight chain, branched chain and cyclicgroups having one or more double bond. The alkenyl group may haveone double bond, two double bonds, three double bonds, etc.Examples of alkenyl groups are ethenyl, propenyl, butenyl,cyclohexenyl, etc. The alkenyl group may be unsubstituted orsubstituted by one or more groups selected from halogen, hydroxy,alkoxy carbonyl, amido, alkylamido, dialkylamido, nitro, amino,alkylamino, dialkylamino, carboxyl thio and thioalkyl.

A "haloalkyl" group refers to an alkyl group as defined above,which is substituted by one or more halogen atoms, in oneembodiment by F, in another embodiment by Cl, in another embodimentby Br, or in another embodiment by 1.

An "aryl" group refers to an aromatic group having at least onecarbocyclic aromatic group or heterocyclic aromatic group, whichmay be unsubstituted or substituted by one or more groups selectedfrom halogen, haloalkyl, hydroxy, alkoxy carbonyl, amido,alkylamido, dialkylamido, nitro, amino, alkylamino, dialkylamino,carboxy or thio or thioalkyl. Nonlimiting examples of aryl ringsare phenyl, naphthyl, pyranyl, pyrrolyl, pyrazinyl, pyrimidinyl,pyrazolyl, pyridinyl, furanyl, thiophenyl, thiazolyl, imidazolyl,isoxazolyl, and the like. In one embodiment, the aryl group is a1-12 membered ring. In another embodiment, the aryl group is a 1-8membered ring. In another embodiment, the aryl group comprises of1-4 fused rings.

A "hydroxyl" group refers to an OH group. It is understood by aperson skilled in the art that when T is OR, R is not OH.

In one embodiment, the term "halogen" refers to in one embodimentto F, in another embodiment to Cl, in another embodiment to Br, orin another embodiment to 1.

An "arylalkyl" group refers, in another embodiment, to an alkylbound to an aryl, wherein alkyl and aryl are as defined above. Anexample of an arylalkyl group is a benzyl group.

In one embodiment, this invention provides for the use of acompound as herein described and/or, its analog, derivative,isomer, metabolite, pharmaceutically acceptable salt,pharmaceutical product, hydrate, N-oxide, prodrug, polymorph,impurity or crystal or combinations thereof.

In one embodiment, the term "isomer" includes, but is not limitedto, optical isomers and analogs, structural isomers and analogs,conformational isomers and analogs, and the like.

In one embodiment, the term "isomer" is meant to encompass opticalisomers of the SARM compound. It will be appreciated by thoseskilled in the art that the SARMs of the present invention containat least one chiral center. Accordingly, the SARMs used in themethods of the present invention may exist in, and be isolated in,optically-active or racemic forms. Some compounds may also exhibitpolymorphism. It is to be understood that the present inventionencompasses any racemic, optically-active, polymorphic, orstereoisomeric form, or mixtures thereof, which form possessesproperties useful in the treatment of androgen-related conditionsdescribed herein. In one embodiment, the SARMs are the pure(R)-isomers. In another embodiment, the SARMs are the pure(S)-isomers. In another embodiment, the SARMs are a mixture of the(R) and the (S) isomers. In another embodiment, the SARMs are aracemic mixture comprising an equal amount of the (R) and the (S)isomers. It is well known in the art how to prepareoptically-active forms (for example, by resolution of the racemicform by recrystallization techniques, by synthesis fromoptically-active starting materials, by chiral synthesis, or bychromatographic separation using a chiral stationary phase).

The invention includes "pharmaceutically acceptable salts" of thecompounds of this invention, which may be produced, by reaction ofa compound of this invention with an acid or base.

Suitable pharmaceutically-acceptable salts of amines of formulasI-XX may be prepared from an inorganic acid or from an organicacid. In one embodiment, examples of inorganic salts of amines arebisulfates, borates, bromides, chlorides, hemisulfates,hydrobromates, hydrochlorates, 2-hydroxyethylsulfonates(hydroxyethanesulfonates), iodates, iodides, isothionates, nitrate,persulfates, phosphates, sulfates, sulfamates, sulfanilates,sulfonic acids (alkylsulfonates, arylsulfonates, halogensubstituted alkylsulfonates, halogen substituted arylsulfonates),sulfonates and thiocyanates.

In one embodiment, examples of organic salts of amines may beselected from aliphatic, cycloaliphatic, aromatic, araliphatic,heterocyclic, carboxylic and sulfonic classes of organic acids,examples of which are acetates, arginines, aspartates, ascorbates,adipates, anthranilates, algenates, alkane carboxylates,substituted alkane carboxylates, alginates, benzenesulfonates,benzoates, bisulfates, butyrates, bicarbonates, bitartrates,carboxylates, citrates, camphorates, camphorsulfonates,cyclohexylsulfamates, cyclopentanepropionates, calcium edetates,camsylates, carbonates, clavulanates, cinnamates, dicarboxylates,digluconates, dodecylsulfonates, dihydrochlorides, decanoates,enanthuates, ethanesulfonates, edetates, edisylates, estolates,esylates, fumarates, formates, fluorides, galacturonates,gluconates, glutamates, glycolates, glucorates, glucoheptanoates,glycerophosphates, gluceptates, glycollylarsanilates, glutarates,glutamates, heptanoates, hexanoates, hydroxymaleates,hydroxycarboxylic acids, hexylresorcinates, hydroxybenzoates,hydroxynaphthoates, hydrofluorate, lactates, lactobionates,laurates, malates, maleates, methylenebis(beta-oxynaphthoate),malonates, mandelates, mesylates, methane sulfonates,methylbromides, methylnitrates, methylsulfonates, monopotassiummaleates, mucates, monocarboxylates, naphthalenesulfonates,2-naphthalenesulfonates, nicotinates, napsylates,N-methylglucamines, oxalates, octanoates, oleates, pamoates,phenylacetates, picrates, phenylbenzoates, pivalates, propionates,phthalates, phenylacetate, pectinates, phenylpropionates,palmitates, pantothenates, polygalacturates, pyruvates, quinates,salicylates, succinates, stearates, sulfanilate, subacetates,tartarates, theophyllineacetates, p-toluenesulfonates (tosylates),trifluoroacetates, terephthalates, tannates, teoclates,trihaloacetates, triethiodide, tricarboxylates, undecanoates andvalerates.

In one embodiment, examples of inorganic salts of carboxylic acidsor phenols may be selected from ammonium, alkali metals to includelithium, sodium, potassium, or cesium; alkaline earth metals toinclude calcium, magnesium, or aluminium; zinc, barium, cholines,or quaternary ammoniums.

In another embodiment, examples of organic salts of carboxylicacids or phenols may be selected from arginine, organic amines toinclude aliphatic organic amines, alicyclic organic amines,aromatic organic amines, benzathines, t-butylamines, benethamines(N-benzylphenethylamine), dicyclohexylamines, dimethylamines,diethanolamines, ethanolamines, ethylenediamines, hydrabamines,imidazoles, lysines, methylamines, meglamines,N-methyl-D-glucamines, N,N'-dibenzylethylenediamines,nicotinamides, organic amines, ornithines, pyridines, picolines,piperazines, procaine, tris(hydroxymethyl)methylamines,triethylamines, triethanolamines, trimethylamines, tromethaminesand ureas.

In one embodiment, the salts may be formed by conventional means,such as by reacting the free base or free acid form of the productwith one more equivalents of the appropriate acid or base in asolvent or medium in which the salt is insoluble or in a solventsuch as water, which is removed in vacuo or by freeze drying or byexchanging the ions of a existing salt for another ion or suitableion-exchange resin.

The invention also includes use of N-oxides of the aminosubstituents of the compounds described herein.

This invention provides for the use of derivatives of the compoundsas herein described. In one embodiment, "derivatives" includes butis not limited to ether derivatives, acid derivatives, amidederivatives, ester derivatives and the like. In another embodiment,this invention further includes use of hydrates of the compounds asdescribed herein. In one embodiment, "hydrate" includes but is notlimited to hemihydrate, monohydrate, dihydrate, trihydrate and thelike.

This invention provides, in other embodiments, use of metabolitesof the compounds as herein described. In one embodiment,"metabolite" means any substance produced from another substance bymetabolism or a metabolic process.

This invention provides, in other embodiments, use ofpharmaceutical products of the compounds as herein described. Theterm "pharmaceutical product" refers, in other embodiments, to acomposition suitable for pharmaceutical use (pharmaceuticalcomposition), for example, as described herein.

Compounds as herein described may be prepared by any means known inthe art, including inter alia, those described in U.S. patentapplication Ser. No. 11/505,363 and U.S. patent application Ser.No. 11/505,499; fully incorporated by reference herein in theirentirety.

In some embodiments, the compounds for use in the methods of thisinvention are nonsteroidal ligands for the androgen receptor andmay demonstrate tissue-selective androgenic and/or anabolicactivity. These novel agents are useful in males for the treatmentof a variety of hormone-related conditions such as sexualdysfunction, decreased sexual libido, erectile dysfunction,hypogonadism, sarcopenia, osteopenia, osteoporosis, alterations incognition and mood, depression, anemia, hair loss, obesity, benignprostate hyperplasia and/or prostate cancer. Further, the compoundsare useful for oral testosterone replacement therapy, and treatingprostate cancer. In other embodiments, the compounds are useful forthe treatment of a variety of hormone-related conditions in femalesincluding, sexual dysfunction, decreased sexual libido,hypogonadism, sarcopenia, osteopenia, osteoporosis, alterations incognition and mood, depression, anemia, hair loss, obesity,endometriosis, infertility, breast cancer, uterine cancer andovarian cancer. In other embodiments, the SARMs are useful fortreating, suppressing, inhibiting or reducing the incidence ofdiabetes type II, diabetes type I, glucose intolerance,hyperinsulinemia, insulin resistance, dyslipidemia,hypercholesterolemia, high blood pressure, obesity, fatty liverconditions, diabetic nephropathy, diabetic neuropathy, diabeticretinopathy, cardiovascular disease, atherosclerosis,cerebrovascular conditions and stroke.

In some embodiments, the compounds as described herein are usefulin preventing and treating muscle wasting disorders, bone relateddisorders, and diabetes related disorders.

In some embodiments, the compounds as described herein are usefulin the treatment of a) muscle wasting in patients with cancer,wherein the patients are subjected to cancer therapy; b) musclewasting in patients with non-small cell lung cancer (NSCLC),wherein the patients are subjected to cancer therapy; c) musclewasting in patients with non-small cell lung cancer (NSCLC),wherein the patients are subjected to taxane therapy; d)pre-cachexia or early cachexia (preventing muscle wasting in acancer patient), wherein the patients are subjected to cancertherapy e) treating loss of physical function due to cancer orcancer therapy (radiation, chemotherapy, surgery); f) increasingphysical function of a subject, wherein the subject is subjected tocancer therapy; g) increasing physical function of a cancerpatient, wherein the patient is subjected to cancer therapy; h)increasing physical function of a cancer patient, wherein saidpatient suffers from non-small cell lung cancer, colorectal cancer,non-Hodgkin lymphoma, chronic lymphocytic leukemia or breastcancer, and is subjected to cancer therapy; i) increasing physicalfunction of a cancer patient, wherein said patient suffers fromnon-small cell lung cancer, and is subjected to taxane therapy; j)treating, suppressing, inhibiting, reducing the severity of,reducing the incidence of, reducing the pathogenesis of or delayingonset of, ng cancer in a patient, wherein the patient is subjectedto cancer therapy; k) increasing survival, functional independence,and increasing quality of life of a subject suffering from cancer,and is subjected to cancer therapy; l) increasing survival,functional independence, and increasing quality of life of asubject suffering from non-small cell lung cancer, and is subjectedto taxane therapy; m) preventing or treating declines in quality oflife due to cancer or cancer therapy, and treating diseases,disorders or conditions related thereto; n) increasing lean bodymass of a cancer patient, and is subjected to cancer therapy; or o)increasing lean body mass of a cancer patient, wherein said patientsuffers from non-small cell lung cancer, and is subjected to taxanetherapy; via the administration of any SARM as herein described andoptionally other therapeutic agents, including but not limited tochemotherapeutic agents, or compositions comprising the same. Inanother embodiment, the compounds as described herein areadministered to cancer patients that are subjected to cancertherapy. In another embodiment, the compounds as described hereinare administered to cancer patients that are subjected to radiationtherapy. In another embodiment, the compounds as described hereinare administered to cancer patients that are subjected to taxanetherapy. In another embodiment, the compounds as described hereinare administered to cancer patients that are subjected to taxanetherapy in combination with platinum therapy. In anotherembodiment, the compounds as described herein are administered tocancer patients that are subjected to platinum therapy incombination with non-taxane chemotherapeutic agent(s). In anotherembodiment, the compounds as described herein are administered incombination with radiation therapy. In another embodiment, thecompounds as described herein are administered in combination withother therapeutic agents. In another embodiment, the compounds asdescribed herein are administered in combination withchemotherapeutic agents.

In some embodiments, the compounds as described herein are useful,either alone or as a composition, in males and females for thetreatment of a variety of hormone-related conditions, such ashypogonadism, sarcopenia, erectile dysfunction, lack of libido,osteoporosis and fertility. In some embodiments, the compounds asdescribed herein are useful in stimulating or promoting orrestoring function to various processes, which in turn result inthe treatment of the conditions as herein described, including,inter alia, promoting erythropoiesis, osteogenesis, muscle growth,glucose uptake, insulin secretion, and/or preventing lipidogenesis,clotting, insulin resistance, atherosclerosis, osteoclast activity,and others.

In one embodiment, the methods of this invention make use of thedescribed compound contacting or binding a receptor, and therebymediating the described effects. In some embodiments, the receptoris a nuclear receptor, which in one embodiment, is an androgenreceptor, or in another embodiment, is an estrogen receptor, or inanother embodiment, is a progesterone receptor, or in anotherembodiment, is a glucocorticoid receptor. In some embodiments, themultitude of effects may occur simultaneously, as a function ofbinding to multiple receptors in the subject. In some embodiments,the tissue selective effects of the compounds as described hereinprovide for simultaneous action on different target organs.

In some embodiments, tissue selectivity may be a function ofspecific promoter interaction, as exemplified herein in Example10.

Pharmaceutical Compositions

In some embodiments, this invention provides methods of use whichcomprise administering a composition comprising the describedcompounds. As used herein, "pharmaceutical composition" means a"therapeutically effective amount" of the active ingredient, i.e.the SARM compound, together with a pharmaceutically acceptablecarrier or diluent. A "therapeutically effective amount" as usedherein refers to that amount which provides a therapeutic effectfor a given condition and administration regimen.

As used herein, the term "administering" refers to bringing asubject in contact with a SARM compound of the present invention.As used herein, administration can be accomplished in vitro, i.e.in a test tube, or in vivo, i.e. in cells or tissues of livingorganisms, for example humans. In one embodiment, the presentinvention encompasses administering the compounds of the presentinvention to a subject.

In one embodiment, this invention is directed to a compositioncomprising a compound of formula S-(III):

##STR00027## or its isomer, pharmaceutically acceptable salt,pharmaceutical product, hydrate, N-oxide, or any combinationthereof, and a chemotherapeutic agent.

In one embodiment, this invention is directed to a compositioncomprising a compound of formula S-(III):

##STR00028## or its isomer, pharmaceutically acceptable salt,pharmaceutical product, hydrate, N-oxide, or any combinationthereof; and a platinum and a taxane.

In one embodiment, this invention is directed to a compositioncomprising a compound of formula S-(III):

##STR00029##

or its isomer, pharmaceutically acceptable salt, pharmaceuticalproduct, hydrate, N-oxide, or any combination thereof, and aplatinum and a non-taxane chemotherapeutic agent.

The pharmaceutical compositions containing a SARM compound of thisinvention can be administered to a subject by any method known to aperson skilled in the art, such as orally, parenterally,intravascularly, paracancerally, transmucosally, transdermally,intramuscularly, intranasally, intravenously, intradermally,subcutaneously, sublingually, intraperitoneally,intraventricularly, intracranially, intravagin*lly, by inhalation,rectally, intratumorally, or by any means in which the recombinantvirus/composition can be delivered to tissue (e.g., needle orcatheter). Alternatively, topical administration may be desired forapplication to mucosal cells, for skin or ocular application.Another method of administration is via aspiration or aerosolformulation.

In one embodiment, the pharmaceutical compositions are administeredorally, and are thus formulated in a form suitable for oraladministration, i.e. as a solid or a liquid preparation. Suitablesolid oral formulations include tablets, capsules, pills, granules,pellets, powders, and the like. Suitable liquid oral formulationsinclude solutions, suspensions, dispersions, emulsions, oils andthe like. In one embodiment of the present invention, the SARMcompounds are formulated in a capsule. In accordance with thisembodiment, the compositions of the present invention comprise inaddition to the SARM active compound and the inert carrier ordiluent, a hard gelatin capsule.

In one embodiment, the micronized capsules comprise particlescontaining a SARM of this invention, wherein the term "micronized"used herein refers to particles having a particle size is of lessthan 100 microns, or in another embodiment, less than 50 microns,or in another embodiment, less than 35 microns, or in anotherembodiment, less than 15 microns, or in another embodiment, lessthan 10 microns, or in another embodiment, less than 5 microns.

Further, in another embodiment, the pharmaceutical compositions areadministered by intravenous, intraarterial, or intramuscularinjection of a liquid preparation. Suitable liquid formulationsinclude solutions, suspensions, dispersions, emulsions, oils andthe like. In one embodiment, the pharmaceutical compositions areadministered intravenously, and are thus formulated in a formsuitable for intravenous administration. In another embodiment, thepharmaceutical compositions are administered intraarterially, andare thus formulated in a form suitable for intraarterialadministration. In another embodiment, the pharmaceuticalcompositions are administered intramuscularly, and are thusformulated in a form suitable for intramuscular administration.

Further, in another embodiment, the pharmaceutical compositions areadministered topically to body surfaces, and are thus formulated ina form suitable for topical administration. Suitable topicalformulations include gels, ointments, creams, lotions, drops andthe like. For topical administration, the SARM agents or theirphysiologically tolerated derivatives such as salts, esters,N-oxides, and the like are prepared and applied as solutions,suspensions, or emulsions in a physiologically acceptable diluentwith or without a pharmaceutical carrier.

Further, in another embodiment, the pharmaceutical compositions areadministered as a suppository, for example a rectal suppository ora urethral suppository. Further, in another embodiment, thepharmaceutical compositions are administered by subcutaneousimplantation of a pellet. In a further embodiment, the pelletprovides for controlled release of SARM agent over a period oftime. In a further embodiment, the pharmaceutical compositions areadministered intravagin*lly.

In another embodiment, the active compound can be delivered in avesicle, in particular a liposome (see Langer, Science249:1527-1533 (1990); Treat et al., in Liposomes in the Therapy ofInfectious Disease and Cancer, Lopez-Berestein and Fidler (eds.),Liss, New York, pp. 353-365 (1989); Lopez-Berestein, ibid., pp.317-327; see generally ibid).

As used herein "pharmaceutically acceptable carriers or diluents"are well known to those skilled in the art. The carrier or diluentmay be a solid carrier or diluent for solid formulations, a liquidcarrier or diluent for liquid formulations, or mixturesthereof.

Solid carriers/diluents include, but are not limited to, a gum, astarch (e.g. corn starch, pregeletanized starch), a sugar (e.g.,lactose, mannitol, sucrose, dextrose), a cellulosic material (e.g.microcrystalline cellulose), an acrylate (e.g. polymethylacrylate),calcium carbonate, magnesium oxide, talc, or mixtures thereof.

In one embodiment, the compositions of this invention may include,a SARM of this invention or any combination thereof, together withone or more pharmaceutically acceptable excipients.

Suitable excipients and carriers may be, according to embodimentsof the invention, solid or liquid and the type is generally chosenbased on the type of administration being used. Liposomes may alsobe used to deliver the composition. Examples of suitable solidcarriers include lactose, sucrose, gelatin and agar. Oral dosageforms may contain suitable binders, lubricants, diluents,disintegrating agents, coloring agents, flavoring agents,flow-inducing agents, and melting agents. Liquid dosage forms maycontain, for example, suitable solvents, preservatives, emulsifyingagents, suspending agents, diluents, sweeteners, thickeners, andmelting agents. Parenteral and intravenous forms should alsoinclude minerals and other materials to make them compatible withthe type of injection or delivery system chosen. Of course, otherexcipients may also be used.

For liquid formulations, pharmaceutically acceptable carriers maybe aqueous or non-aqueous solutions, suspensions, emulsions oroils. Examples of non-aqueous solvents are propylene glycol,polyethylene glycol, and injectable organic esters such as ethyloleate. Aqueous carriers include water, alcoholic/aqueoussolutions, cyclodextrins, emulsions or suspensions, includingsaline and buffered media. Examples of oils are those of petroleum,animal, vegetable, or synthetic origin, for example, peanut oil,soybean oil, mineral oil, olive oil, sunflower oil, and fish-liveroil.

Parenteral vehicles (for subcutaneous, intravenous, intraarterial,or intramuscular injection) include sodium chloride solution,Ringer's dextrose, dextrose and sodium chloride, lactated Ringer'sand fixed oils. Intravenous vehicles include fluid and nutrientreplenishers, electrolyte replenishers such as those based onRinger's dextrose, and the like. Examples are sterile liquids suchas water and oils, with or without the addition of a surfactant andother pharmaceutically acceptable adjuvants. In general, water,saline, aqueous dextrose and related sugar solutions, and glycolssuch as propylene glycols or polyethylene glycol are preferredliquid carriers, particularly for injectable solutions. Examples ofoils are those of petroleum, animal, vegetable, or syntheticorigin, for example, peanut oil, soybean oil, mineral oil, oliveoil, sunflower oil, and fish-liver oil.

In addition, the compositions may further comprise binders (e.g.acacia, cornstarch, gelatin, carbomer, ethyl cellulose, guar gum,hydroxypropyl cellulose, hydroxypropyl methyl cellulose, povidone),disintegrating agents (e.g. cornstarch, potato starch alginic acid,silicon dioxide, croscarmellose sodium, crospovidone, guar gum,sodium starch glycolate), buffers (e.g., Tris-HCl, acetate,phosphate) of various pH and ionic strength, additives such asalbumin or gelatin to prevent absorption to surfaces, detergents(e.g., Tween.RTM. 20, Tween.RTM. 80, Pluronic F68.RTM., bile acidsalts), protease inhibitors, surfactants (e.g. sodium laurylsulfate), permeation enhancers, solubilizing agents (e.g.,Cremophor.RTM., glycerol, polyethylene glycerol, benzalkoniumchloride, benzyl benzoate, cyclodextrins, sobitan esters, stearicacids), anti-oxidants (e.g., ascorbic acid, sodium metabisulfite,butylated hydroxyanisole), stabilizers (e.g. hydroxypropylcellulose, hydroxypropylmethyl cellulose), viscosity increasingagents (e.g. carbomer, colloidal silicon dioxide, ethyl cellulose,guar gum), sweetners (e.g. aspartame, citric acid), preservatives(e.g., Thimerosal.RTM., benzyl alcohol, parabens), coloring agents,lubricants (e.g. stearic acid, magnesium stearate, polyethyleneglycol, sodium lauryl sulfate), flow-aids (e.g. colloidal silicondioxide), plasticizers (e.g. diethyl phthalate, triethyl citrate),emulsifiers (e.g. carbomer, hydroxypropyl cellulose, sodium laurylsulfate), polymer coatings (e.g., poloxamers or poloxamines),coating and film forming agents (e.g. ethyl cellulose, acrylates,polymethacrylates), and/or adjuvants.

In one embodiment, the pharmaceutical compositions provided hereinare controlled release compositions, i.e. compositions in which theSARM compound is released over a period of time afteradministration. Controlled or sustained release compositionsinclude formulation in lipophilic depots (e.g. fatty acids, waxes,oils). In another embodiment, the composition is an immediaterelease composition, i.e. a composition in which all of the SARMcompound is released immediately after administration.

In another embodiment, the pharmaceutical composition can bedelivered in a controlled release system. For example, the agentmay be administered using intravenous infusion, an implantableosmotic pump, a transdermal patch, liposomes, or other modes ofadministration. In one embodiment, a pump may be used (see Langer,supra; Sefton, CRC Crit. Ref. Biomed. Eng. 14:201 (1987); Buchwaldet al., Surgery 88-507 (1980); Saudek et al, N. Engl. J. Med.321:574 (1989). In another embodiment, polymeric materials can beused. In yet another embodiment, a controlled release system can beplaced in proximity to the therapeutic target, i.e., the brain,thus requiring only a fraction of the systemic dose (see, e.g.,Goodson, in Medical Applications of Controlled Release, supra, vol.2, pp. 115-138 (1984). Other controlled release systems arediscussed in the review by Langer (Science 249:1527-1533(1990).

The compositions may also include incorporation of the activematerial into or onto particulate preparations of polymericcompounds such as polylactic acid, polyglycolic acid, hydrogels,etc, or onto liposomes, microemulsions, micelles, unilamellar ormultilamellar vesicles, erythrocyte ghosts, or spheroplasts. Suchcompositions will influence the physical state, solubility,stability, rate of in vivo release, and rate of in vivoclearance.

Also comprehended by the invention are particulate compositionscoated with polymers (e.g. poloxamers or poloxamines) and thecompound coupled to antibodies directed against tissue-specificreceptors, ligands or antigens or coupled to ligands oftissue-specific receptors.

Also comprehended by the invention are compounds modified by thecovalent attachment of water-soluble polymers such as polyethyleneglycol, copolymers of polyethylene glycol and polypropylene glycol,carboxymethyl cellulose, dextran, polyvinyl alcohol,polyvinylpyrrolidone or polyproline. The modified compounds areknown to exhibit substantially longer half-lives in blood followingintravenous injection than do the corresponding unmodifiedcompounds (Abuchowski et al., 1981; Newmark et al., 1982; and Katreet al., 1987). Such modifications may also increase the compound'ssolubility in aqueous solution, eliminate aggregation, enhance thephysical and chemical stability of the compound, and greatly reducethe immunogenicity and reactivity of the compound. As a result, thedesired in vivo biological activity may be achieved by theadministration of such polymer-compound abducts less frequently orin lower doses than with the unmodified compound.

The preparation of pharmaceutical compositions, which contain anactive component is well understood in the art, for example bymixing, granulating, or tablet-forming processes. The activetherapeutic ingredient is often mixed with excipients which arepharmaceutically acceptable and compatible with the activeingredient. For oral administration, the SARM agents or theirphysiologically tolerated derivatives such as salts, esters,N-oxides, and the like are mixed with additives customary for thispurpose, such as vehicles, stabilizers, or inert diluents, andconverted by customary methods into suitable forms foradministration, such as tablets, coated tablets, hard or softgelatin capsules, aqueous, alcoholic or oily solutions. Forparenteral administration, the SARM agents or their physiologicallytolerated derivatives such as salts, esters, N-oxides, and the likeare converted into a solution, suspension, or emulsion, if desiredwith the substances customary and suitable for this purpose, forexample, solubilizers or other.

An active component can be formulated into the composition asneutralized pharmaceutically acceptable salt forms.Pharmaceutically acceptable salts include the acid addition salts(formed with the free amino groups of the polypeptide or antibodymolecule), which are formed with inorganic acids such as, forexample, hydrochloric or phosphoric acids, or such organic acids asacetic, oxalic, tartaric, mandelic, and the like. Salts formed fromthe free carboxyl groups can also be derived from inorganic basessuch as, for example, sodium, potassium, ammonium, calcium, orferric hydroxides, and such organic bases as isopropylamine,trimethylamine, 2-ethylamino ethanol, histidine, procaine, and thelike.

For use in medicine, the salts of the compounds of formula I-XX andS-(III) will be pharmaceutically acceptable salts. Other salts may,however, be useful in the preparation of the compounds according tothe invention or of their pharmaceutically acceptable salts.Suitable pharmaceutically acceptable salts of the compounds of thisinvention include acid addition salts which may, for example, beformed by mixing a solution of the compound according to theinvention with a solution of a pharmaceutically acceptable acidsuch as hydrochloric acid, sulphuric acid, methanesulphonic acid,fumaric acid, maleic acid, succinic acid, acetic acid, benzoicacid, oxalic acid, citric acid, tartaric acid, carbonic acid orphosphoric acid.

In one embodiment, this invention provides pharmaceuticalcompositions comprising compound I-XX and S-(III) of thisinvention. In one embodiment, such compositions are useful for oraltestosterone replacement therapy.

In one embodiment, this invention also provides a compositioncomprising two or more compounds of I-XX and S-(III) of thisinvention, or polymorphs, isomers, hydrates, salts, N-oxides, etc.,thereof. The present invention also relates to compositions and apharmaceutical compositions which comprises a SARM alone or incombination with another therapeutic agent. Therapeutic agentsinclude but are not limited to: progestin or estrogen,chemotherapeutic compounds, osteogenic or myogenic compounds, orother agents suitable for the applications as herein described. Inone embodiment, the compositions of this invention will comprise asuitable carrier, diluent or salt.

In one embodiment, the methods of this invention may compriseadministration of a compound of formula I-XX and S-(III) of thisinvention at various dosages. In one embodiment, the compound offormula I-XX and S-(III) is administered at a dosage of 0.01-1 mgper day. In one embodiment, compound of formula I-XX and S-(III) isadministered at a dosage of 0.1-200 mg per day. In one embodiment,compound of formula I-XX and S-(III) is administered at a dose of0.1-10 mg per day, or in another embodiment, 0.1-25 mg per day, orin another embodiment, 0.1-50 mg per day, or in another embodiment,0.3-15 mg per day, or in another embodiment, 0.3-30 mg per day, orin another embodiment, 0.5-25 mg per day, or in another embodiment,0.5-50 mg per day, or in another embodiment, 0.75-15 mg per day, orin another embodiment, 0.75-60 mg per day, or in anotherembodiment, 1-5 mg per day, or in another embodiment, 1-20 mg perday, or in another embodiment, 3-15 mg per day, or in anotherembodiment, 30-50 mg, or in another embodiment, 30-75 mg per day,or in another embodiment, 100-2000 mg per day.

In one embodiment, the methods of this invention may compriseadministration of a compound of formula and S-(III) at variousdosages. In one embodiment, compound of formula S-(III) isadministered at a dosage of 1 mg. In one embodiment, compound offormula S-(III) is administered at a dosage of 3 mg. In anotherembodiment the compound of formula S-(III) is administered at adosage of 0.01 mg, 0.03 mg, 0.1 mg, 0.3 mg, 0.75 mg, 5 mg, 10 mg,15 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg, 60mg, 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg or 100 mg.

In one embodiment, the compound of formula and S-(III) of thisinvention may be administered at various dosages. In oneembodiment, compound of formula and S-(III) is administered at adosage of 0.01-1 mg per day. In one embodiment, compound of formulaand S-(III) is administered at a dosage of 0.1-200 mg per day. Inone embodiment, compound of formula and S-(III) is administered ata dose of 0.1-10 mg per day, or in another embodiment, 0.1-25 mgper day, or in another embodiment, 0.1-50 mg per day, or in anotherembodiment, 0.3-15 mg per day, or in another embodiment, 0.3-30 mgper day, or in another embodiment, 0.5-25 mg per day, or in anotherembodiment, 0.5-50 mg per day, or in another embodiment, 0.75-15 mgper day, or in another embodiment, 0.75-60 mg per day, or inanother embodiment, 1-5 mg per day, or in another embodiment, 1-20mg per day, or in another embodiment, 3-15 mg per day, or inanother embodiment, 30-50 mg, or in another embodiment, 30-75 mgper day, or in another embodiment, 100-2000 mg per day.

In one embodiment, the present invention provides methods of usecomprising the administration of a pharmaceutical composition ofthis invention comprising: a) any embodiment of a compound asdescribed herein; and b) a pharmaceutically acceptable carrier ordiluent; which is to be understood to include an analog, isomer,metabolite, derivative, pharmaceutically acceptable salt, N-oxide,hydrate or any combination thereof of a compound as hereindescribed, and may comprise compounds of formulas I-XX andS-(III).

In some embodiments, the present invention provides methods of useof a pharmaceutical composition comprising: a) any embodiment ofthe compounds as described herein, including an analog, isomer,metabolite, derivative, pharmaceutically acceptable salt,pharmaceutical product, N-oxide, hydrate thereof or any combinationthereof; b) a pharmaceutically acceptable carrier or diluent; c) aflow-aid; and d) a lubricant.

In another embodiment, the present invention provides methods ofuse of a pharmaceutical composition comprising: a) any embodimentof the compounds as described herein, including an analog, isomer,metabolite, derivative, pharmaceutically acceptable salt,pharmaceutical product, N-oxide, hydrate thereof or any combinationthereof; b) lactose monohydrate; c) microcrystalline cellulose; d)magnesium stearate; e) additives; and f) colloidal silicondioxide.

In some embodiments, the methods of this invention make use ofcompositions comprising SARM compounds, which offer the advantagethat the compounds are nonsteroidal ligands for the androgenreceptor, and exhibit anabolic activity in vivo. According to thisaspect, such compounds are unaccompanied by serious side effects,provide convenient modes of administration, and lower productioncosts and are orally bioavailable, lack significantcross-reactivity with other undesired steroid receptors, and maypossess long biological half-lives.

For administration to mammals, and particularly humans, it isexpected that the physician will determine the actual dosage andduration of treatment, which will be most suitable for anindividual and can vary with the age, weight and response of theparticular individual.

In one embodiment, the compositions for administration may besterile solutions, or in other embodiments, aqueous or non-aqueous,suspensions or emulsions. In one embodiment, the compositions maycomprise propylene glycol, polyethylene glycol, injectable organicesters, for example ethyl oleate, or cyclodextrins. In anotherembodiment, compositions may also comprise wetting, emulsifyingand/or dispersing agents. In another embodiment, the compositionsmay also comprise sterile water or any other sterile injectablemedium.

In one embodiment, the invention provides compounds andcompositions, including any embodiment described herein, for use inany of the methods of this invention. In one embodiment, use of aSARM or a composition comprising the same, will have utility ininhibiting, suppressing, enhancing or stimulating a desiredresponse in a subject, as will be understood by one skilled in theart. In another embodiment, the compositions may further compriseadditional active ingredients, whose activity is useful for theparticular application for which the SARM compound is beingadministered. In another embodiment, the compositions may furthercomprise chemotherapeutic agents.

In some embodiments, the compositions will further comprise a5.alpha.-reductase inhibitors (5ARI), another SARM, a selectiveestrogen receptor modulator (SERM), an aromatase inhibitor, such asbut not limited to anastrozole, exemestane, or letrozole, a GnRHagonist or antagonist, a steroidal or nonsteroidal GR ligand, asteroidal or nonsterodial PR ligand, a steroidal or nonsteroidal ARantagonist, a 17-aldoketoreductase inhibitor or17.beta.-hydroxysteroid dehydrogenase inhibitor. Such compositionsmay be used, in some embodiments, for treating a hormone dependentcondition, such as, for example, infertility, neoplasia of ahormone-responsive cancer, for example, a gonadal cancer, or aurogenital cancer.

In some embodiments, the composition will comprise the SARMs asdescribed herein, as well as another therapeutic compound,including inter alia, a 5ARI such as finasteride, dutasteride,izonsteride; other SARMs, such as, RU-58642, RU-56279, WS9761 A andB, RU-59063, RU-58841, bexlosteride, LG-2293, L-245976, LG-121071,LG-121091, LG-121104, LGD-2226, LGD-2941, YM-92088, YM-175735,LGD-1331, BMS-357597, BMS-391197, S-40503, BMS-482404, EM-4283,EM-4977, BMS-564929, BMS-391197, BMS-434588, BMS-487745,BMS-501949, SA-766, YM-92088, YM-580, LG-123303, LG-123129, PMCol,YM-175735, BMS-591305, BMS-591309, BMS-665139, BMS-665539, CE-590,116BG33, 154BG31, arcarine, ACP-105; SERMs, such as tamoxifen,4-hydroxytamoxifen, idoxifene, toremifene, ospemifene, droloxifene,raloxifene, arzoxifene, bazedoxifene, PPT(1,3,5-tris(4-hydroxyphenyl)-4-propyl-1H-pyrazole), DPN(diarylpropiolnitrile), lasofoxifene, pipendoxifene, EM-800,EM-652, nafoxidine, zindoxifene, tesmilifene, miproxifenephosphate, RU 58,688, EM 139, ICI 164,384, ICI 182,780, clomiphene,MER-25, diethylstilbestrol, coumestrol genistein, GW5638, LY353581,zuclomiphene, enclomiphene, delmadinone acetate, DPPE,(N,N-diethyl-2-{4-(phenylmethyl)-phenoxy}ethanamine), TSE-424,WAY-070, WAY-292, WAY-818, cyclocommunol, prinaberel, ERB-041,WAY-397, WAY-244, ERB-196, WAY-169122, MF-101, ERb-002, ERB-037,ERB-017, BE-1060, BE-380, BE-381, WAY-358, [.sup.18F]FEDNP,LSN-500307, AA-102, CT-101, CT-102, VG-101; GnRH agonists orantagonists, such as, leuprolide, goserelin, triptorelin,alfaprostol, histrelin, detirelix, ganirelix, antide iturelix,cetrorelix, ramorelix, ganirelix, antarelix teverelix, abarelix,ozarelix, sufugolix, prazarelix, degarelix, NBI-56418, TAK-810,acyline; FSH agonist/antagonist, LH agonist/antagonists, aromataseinhibitors, such as, letrozole, anastrazole, atamestane, fadrozole,minamestane, exemestane, plomestane, liarozole, NKS-01, vorozole,YM-511, finrozole, 4-hydroxyandrostenedione, aminogluethimide,rogletimide; steroidal or nonsteroidal glucocorticoid receptorligands, such as, ZK-216348, ZK-243149, ZK-243185, LGD-5552,mifepristone, RPR-106541, ORG-34517, GW-215864X, sesquicillin,CP-472555, CP-394531, A-222977, AL-438, A-216054, A-276575,CP-394531, CP-409069, UGR-07; steroidal or nonsterodialprogesterone receptor ligands; steroidal or nonsteroidal ARantagonists such as flutamide, hydroxyflutamide, bicalutamide,enzalutamide, nilutamide, hydroxysteroid dehydrogenase inhibitors;PPAR.alpha. ligands such as bezafibrate, fenofibrate, gemfibrozil;PPAR.gamma. ligands such as darglitazone, pioglitazone,rosiglitazone, isaglitazone, rivoglitazone, netoglitazone; dualacting PPAR ligands, such as naveglitazar, farglitazar,tesaglitazar, ragaglitazar, oxeglitazar, PN-2034; PPAR .delta.ligands; 17-ketoreductase inhibitors,3.beta.-DH.DELTA.4,6-isomerase inhibitors,3.beta.-DH.DELTA.4,5-isomerase inhibitors, 17,20 desmolaseinhibitors, p450c17 inhibitors, p450ssc inhibitors, 17,20-lyaseinhibitors, or combinations thereof.

In some embodiments, the compositions will further comprise ghrelinreceptor ligand or growth hormone analogues and secretagogues,IGF-1, IGF-1 analogues and secretagogues, myostatin analogues,proteasome inhibitors, androgenic/anabolic steroid, Enbrel.RTM.,melanocortin 4 receptor agonist, insulins, or combinations thereof.Such compositions may be used, in some embodiments, for treatingsarcopenia or a musculoskeletal condition.

In some embodiments, the composition will comprise the SARMs asdescribed herein, as well as another therapeutic compound,including inter alia, ghrelin receptor ligand or growth hormoneanalogues and secretagogues, such as, pralmorelin, examorelin,tabimorelin, capimorelin, capromorelin, ipamorelin, EP-01572,EP-1572, JMV-1843, an androgenic/anabolic steroid such astestosterone and oxandrolone; a melanocortin 4 receptor agonist,such as bremelanotide; a ghrelin or analogue thereof, such as humanghrelin, CYT-009-GhrQb, L-692429, GHRP-6, SK&F-110679,U-75799E; leptin (metreleptin, pegylated leptin; a leptin receptoragonist, such as LEP(116-130), OB3, [D-Leu4]-OB3, rAAV-leptin,AAV-hOB, rAAVhOB; an insulin (short-, intermediate-, and longacting formulations; a cortisol or corticosteroid, or a combinationthereof.

In some embodiments, the composition comprise the SARMs asdescribed herein, and at least one chemotherapeutic agent,including inter alia, alkylating agents including but not limitedto: cyclophosphamide, mechlorethamine, chlorambucil, and melphalan;antimetabolites, Tubulin antagonists such as taxanes, colchicines,and vinca alkaloids; anthracyclines including but not limited to:daunorubicin, doxorubicin, epirubicin, idarubicin, mitoxantrone andvalrubicin; cytoskeletal disruptors (taxanes) including but notlimited to: pacl*taxel and docetaxel; epothilones; histonedeacetylase inhibitors including but not limited to: vorinostat andromidepsin; inhibitors of topoisomerase II including but notlimited to: etoposide, teniposide and tafluposide; kinaseinhibitors including but not limited to: bortezomib, erlotinib,gefitinib, imatinib and vismodegib; monoclonal antibodies includingbut not limited to: bevacizumab, cetuximab, ipilimumab, ofatumumab,ocrelizumab, panitumab, rituximab and vemrafenib; nucleotideanalogs and precursor analogs including but not limited to:azacitidine, azathioprine, capecitabine, cytarabine, doxifluridine,fluorouracil, gemcitabine, hydroxyurea, mercaptopurine,methotrexate and tioguanine (Thioguanine); peptide antibioticsincluding but not limited to: bleomycin and actinomycin;platinum-based agents including but not limited to: carboplatin,cisplatin and pxaliplatin; retinoids including but not limited to:tretinoin, alitretinoin and bexarotene; vinca alkaloids includingbut not limited to: vinblastine, vincristine, vindesine andvinorelbine; or any combination thereof. In another embodiment, theSARM is compound of formula II as described hereinabove. In anotherembodiment, the SARM is compound of formula S-(III) as describedhereinabove.

In a preferred embodiment, the composition comprise the SARMs asdescribed herein, and at least one chemotherapeutic agent selectedfrom: an alkylating agent, a monoclonal antibody, anantimetabolite, a kinase inhibitor, a topoisomerase (topo) IIinhibitor, a tubulin antagonist or any combination thereof. Inanother embodiment, the SARM is compound of formula II as describedhereinabove. In another embodiment, the SARM is compound of formulaS-(III) as described hereinabove.

In some embodiments, the composition comprises the SARMs asdescribed herein, and at least one chemotherapeutic agent,including inter alia, bendamustine, bevacizumab, bleomycin, calciumfolinate, capecitabine, carboplatin, cetuximab, chlorambucil,cisplatin, cyclophosphamide, cytarabine, dasatinib, docetaxel,doxorubicin, erlotinib, etoposide, fludarabine, fluorouracil,gemcitabine hydrochloride, irinotecan hydrochloride, lapatinib,methotrexate, methylprednisolone acetate, mitoxantrone,mitoxantrone hydrochloride, oxaliplatin, pacl*taxel, pamidronatedisodium, panitumumab, pemetrexed, prednisone, rituximab,trastuzumab, vincristine, vinorelbine or any combination thereof.In another embodiment, the SARM is compound of formula II asdescribed hereinabove. In another embodiment, the SARM is compoundof formula or S-(III) as described hereinabove.

In some embodiments, the composition comprises the SARMs asdescribed herein, and a taxane.

In some embodiments, the composition comprises the SARMs asdescribed herein a taxane agent and platinum agent(s).

In some embodiments, the composition comprises the SARMs asdescribed herein platinum agent(s) and a non-taxanechemotherapeutic agent.

In another embodiment, a taxane (or taxane therapy) includenon-limiting examples such as pacl*taxel, docetaxel or combinationthereof.

In another embodiment, platinum (or platinum therapy) includenon-limiting examples such as cisplatin, carboplatin, oxaliplatinor combination thereof.

In another embodiment, non-taxane chemotherapeutic agent includenon-limiting examples such as gemcitabine, pemetrexed, orvinorelbine or combination thereof.

The invention contemplates, in some embodiments, administration ofcompositions comprising the individual agents, administeredseparately and by similar or alternative routes, formulated asappropriately for the route of administration. The inventioncontemplates, in some embodiments, administration of compositionscomprising the individual agents, administered in the sameformulation. The invention contemplates, in some embodiments,staggered administration, concurrent administration, ofadministration of the various agents over a course of time,however, their effects are synergistic in the subject.

It is to be understood that any of the above means, timings,routes, or combinations thereof, of administration of two or moreagents is to be considered as being encompassed by the phrase"administered in combination", as described herein.

In one embodiment, the SARM compound of this invention isadministered in combination with an anti-cancer agent. In oneembodiment, the anti-cancer agent is a monoclonal antibody. In someembodiments, the monoclonal antibodies are used for diagnosis,monitoring, or treatment of cancer. In one embodiment, monoclonalantibodies react against specific antigens on cancer cells. In oneembodiment, the monoclonal antibody acts as a cancer cell receptorantagonist. In one embodiment, monoclonal antibodies enhance thepatient's immune response. In one embodiment, monoclonal antibodiesact against cell growth factors, thus blocking cancer cell growth.In one embodiment, anti-cancer monoclonal antibodies are conjugatedor linked to anti-cancer or chemotherapeutic drugs, radioisotopes,other biologic response modifiers, other toxins, or a combinationthereof. In one embodiment, anti-cancer monoclonal antibodies areconjugated or linked to a SARM compound as describedhereinabove.

In another embodiment, the present invention includes SARMcompounds of this invention and compositions in which a compound ofthe invention is either combined with, or covalently bound to, anagent bound to a targeting agent, such as a monoclonal antibody(e.g., a murine or humanized monoclonal antibody). In oneembodiment, the agent bound to a targeting agent is a cytotoxicagent. It will be appreciated that the latter combination may allowthe introduction of cytotoxic agents into for example cancer cellswith greater specificity. Thus, the active form of the cytotoxicagent (i.e., the free form) will be present only in cells targetedby the antibody. Of course, the compounds of the invention may alsobe combined with monoclonal antibodies that have therapeuticactivity against cancer.

In one embodiment, the SARM compound of this invention isadministered in combination with a selective tyrosine kinaseinhibitor. In some embodiments, the selective tyrosine kinaseinhibitor inhibits catalytic sites of cancer promoting receptorsthereby inhibiting tumor growth. In one embodiment, a selectivetyrosine kinase inhibitor modulates growth factor signaling. Insome embodiments, the selective tyrosine kinase inhibitor targetsEGFR (ERB B/HER) family members. In one embodiment, the selectivetyrosine kinase inhibitor is a BCR-ABL tyrosine kinase inhibitor.In one embodiment, the selective tyrosine kinase inhibitor is anepidermal growth factor receptor tyrosine kinase inhibitor. In oneembodiment, the selective tyrosine kinase inhibitor is a vascularendothelial growth factor tyrosine kinase inhibitor. In oneembodiment, the selective tyrosine kinase inhibitor is a plateletderived growth factor (PDGF) inhibitor.

In one embodiment, the SARM compound of this invention isadministered in combination with a topoisomerase (topo) IIinhibitor. Topo II inhibitors include but are not limited to:etoposide, teniposide and tafluposide.

In one embodiment, the SARM compound of this invention isadministered in combination with a tubulin antagonist. Tubulinantagonists include but are not limited to: vinca alkaloids such asvinblastine, vincristine, vindesine, vinorelbine, vinflunine, orvinca site binders such as cryptophycin 52, halichondrins,dolastatins, and hemiasterlins; taxanes such as pacl*taxel anddocetaxel, or taxane site binders such as epothilones anddiscodermolide; and colchicine site binders such as colchicine,combrestatin, 2-methoxy estradiol, methoxy benzenesulfonamides(E7010), and ABT-751.

In one embodiment, the SARM compound of this invention isadministered in combination with a cancer vaccine. In oneembodiment, the cancer vaccine is a therapeutic vaccine thus,treating an existing cancer. In some embodiments, the cancervaccine is a prophylactic vaccine thus, preventing the developmentof cancer. In one embodiment, both types of vaccines have thepotential to reduce the burden of cancer. In one embodiment,treatment or therapeutic vaccines are administered to cancerpatients and are designed to strengthen the body's natural defensesagainst cancers that have already developed. In one embodiment,therapeutic vaccines may prevent additional growth of existingcancers, prevent the recurrence of treated cancers, or eliminatecancer cells not killed by prior treatments. In some embodiments,prevention or prophylactic vaccines are administered to healthyindividuals and are designed to target cancer in individuals whopresent high risk for the disease. In one embodiment, the cancervaccine is an antigen/adjuvant vaccine. In one embodiment, thecancer vaccine is a whole cell tumor vaccine. In one embodiment,the cancer vaccine is a dendritic cell vaccine. In one embodiment,the cancer vaccine comprises viral vectors and/or DNA vaccines. Inone embodiment, the cancer vaccine is an idiotype vaccine.

In one embodiment, the SARM compound of this invention isadministered in combination with an chemotherapeutic agent. In oneembodiment, the chemotherapeutic agent is an alkylating agent, suchas but not limited to cyclophosphamide. In one embodiment, thechemotherapeutic agent is a cytotoxic antibiotic such as but notlimited to doxorubicin. In one embodiment, the chemotherapeuticagent is an antimetabolite, such as but not limited tomethotrexate. In one embodiment, the chemotherapeutic agent is avinca alkaloid, such as but not limited to vindesine. In someembodiments, the chemotherapeutic agents include platinum compoundssuch as but not limited to carboplatin, and taxanes such asdocetaxel. In one embodiment, the chemotherapeutic agent is anaromatase inhibitor such as but not limited to anastrazole,exemestane, or letrozole. In one embodiment, the chemotherapeuticagent is a tubulin antagonist, such as but not limited to vincaalkaloids such as vinblastine, vincristine, vindesine, vinorelbine,vinflunine, or vinca site binders such as cryptophycin 52,halichondrins, dolastatins, and hemiasterlins; taxanes such aspacl*taxel and docetaxel, or taxane site binders such asepothilones, and discodermolide; and colchicine site binders suchas colchicine, combrestatin, 2-methoxy estradiol, methoxybenzenesulfonamides (E7010), and ABT-751. In one embodiment, thechemotherapeutic agent is a topoisomerase (topo) II inhibitor, suchas but not limited to etoposide, teniposide and tafluposide.

In one embodiment, the SARM compound of this invention isadministered in combination with a Bax activity modulator such asalisol B acetate. In one embodiment, the SARM compound isadministered in combination with an angiotensin II receptor blockersuch as losartan. In one embodiment, the SARM compound isadministered in combination with selenium, green tea cachecins, sawpalmetto, lycopene, vitamin D, dietary soy, genistein orisoflavone.

In one embodiment, the SARM compound of this invention isadministered in combination with antineoplastic agents, such asalkylating agents, antibiotics, hormonal antineoplastics andantimetabolites. Examples of useful alkylating agents include alkylsulfonates such as busulfan, improsulfan and piposulfan;aziridines, such as a benzodizepa, carboquone, meturedepa anduredepa; ethylenimines and methylmelamines such as altretamine,triethylenemelamine, triethylenephosphoramide,triethylenethiophos-phoramide and trimethylolmelamine; nitrogenmustards such as chlorambucil, chlomaphazine, cyclophosphamide,estramustine, iphosphamide, mechlorethamine, mechlorethamine oxidehydrochloride, melphalan, novembichine, phenesterine,prednimustine, trofosfamide, and uracil mustard; nitroso ureas,such as carmustine, chlorozotocin, fotemustine, lomustine,nimustine, ranimustine, dacarbazine, mannomustine, mitobronitol,mitolactol and pipobroman. More such agents will be known to thosehaving skill in the medicinal chemistry and oncology arts.

In some embodiments, other agents suitable for combination withSARMs include protein synthesis inhibitors such as abrin,aurintricarboxylic acid, chloramphenicol, colicin E3,cycloheximide, diphtheria toxin, edeine A, emetine, erythromycin,ethionine, fluoride, 5-fluorotryptophan, fusidic acid, guanylylmethylene diphosphonate and guanylyl imidodiphosphate, kanamycin,kasugamycin, kirromycin, and O-methyl threonine, modeccin,neomycin, norvaline, pactamycin, paromomycine, puromycin, ricin,.alpha.-sarcin, shiga toxin, showdomycin, sparsomycin,spectinomycin, streptomycin, tetracycline, thiostrepton andtrimethoprim. Inhibitors of DNA synthesis, including alkylatingagents such as dimethyl sulfate, mitomycin C, nitrogen and sulfurmustards, MNNG and NMS; intercalating agents such as acridine dyes,actinomycins, adriamycin, anthracenes, benzopyrene, ethidiumbromide, propidium diiodide-intertwining, and agents such asdistamycin and netropsin, can also be combined with compounds ofthe present invention in pharmaceutical compositions. DNA baseanalogs such as acyclovir, adenine, .beta.-1-D-arabinoside,amethopterin, aminopterin, 2-aminopurine, aphidicolin,8-azaguanine, azaserine, 6-azauracil, 2'-azido-2'-deoxynucliosides,5-bromodeoxycytidine, cytosine, .beta.-1-D-arabinoside,diazooxynorleucine, dideoxynucleosides, 5-fluorodeoxycytidine,5-fluorodeoxyuridine, 5-fluorouracil, hydroxyurea and6-mercaptopurine also can be used in combination therapies with thecompounds of the invention. Topoisomerase inhibitors, such ascoumermycin, nalidixic acid, novobiocin and oxolinic acid,inhibitors of cell division, including colcemide, colchicine,vinblastine and vincristine; and RNA synthesis inhibitors includingactinomycin D, .alpha.-amanitine and other fungal amatoxins,cordycepin (3'-deoxyadenosine), dichororibofuranosyl benzimidazole,rifampicine, streptovaricin and streptolydigin also can be combinedwith the compounds of the invention to provide pharmaceuticalcompositions.

In one embodiment, the SARM compound of this invention isadministered in combination with a vaccine for prostate cancer,alisol B acetate, angiotensin II receptor blocker, or others knownin the art. In one embodiment, the SARM compound is administered incombination with an agent to decrease prostate (benign ormalignant) hypertrophy, such as, for example, selenium, green teacachecins, saw palmetto, lycopene, vitamin D, dietary soy,genistein and isoflavone food product and others.

In one embodiment, the SARM compound of this invention isadministered in combination with an immunomodulating agent. In oneembodiment, the immunomodulating agent is an immunosuppressiveagent. In one embodiment, immunosuppressive agents comprisecorticosteroids, cyclosporine, azathioprine, methotrexate,cyclophosphamide, tacrolimus or FK-506, anti-thymocyte globulin,mycophenylate moeftil, or a combination thereof. In one embodiment,the corticosteroid is a glucocorticoid.

In one embodiment, the immunomodulating agent is animmunostimulatory agent. In one embodiment, the immunostimulatoryagent is a specific immunostimulator thus, provides antigenicspecificity during an immune response, such as a vaccine or anyantigen. In one embodiment, the immunostimulatory agent is anon-specific immunostimulator thus, acting irrespective ofantigenic specificity to augment immune response of other antigenor stimulate components of the immune system without antigenicspecificity. In one embodiment, the non-specific immunostimulatoris Freund's.RTM. complete adjuvant. In one embodiment, thenon-specific immunostimulator is Freund's.RTM. incomplete adjuvant.In one embodiment, the non-specific immunostimulator is a montanideISA adjuvant. In one embodiment, the non-specific immunostimulatoris a Ribi's.RTM. adjuvant. In one embodiment, the non-specificimmunostimulator is a Hunter's TiterMax.RTM.. In one embodiment,the non-specific immunostimulator is an aluminum salt adjuvant. Inone embodiment, the non-specific immunostimulator is anitrocellulose-adsorbed protein. In one embodiment, thenon-specific immunostimulator is a Gerbu Adjuvant.RTM..

In one embodiment, the SARM compound of this invention isadministered in combination with an agent, which treats bonediseases, disorders or conditions, such as osteoporosis, bonefractures, etc., and this invention comprises methods of treatingthe same, by administering the SARMs as herein described, alone orin combination with other agents.

In one embodiment, the methods provided herein and/or utilizing thecompositions provided herein, are effective in reducing metastasesto the bone, such as in terms of number of foci, the size of foci,or a combination thereof. According to this aspect of the inventionand in one embodiment, provided herein is a method of preventing orinhibiting cancer metastasis to bone in a subject, comprising thestep of administering to the subject a composition comprising acompound of this invention in combination with toremifene,raloxifene, tamoxifen or an analogue, functional derivative,metabolite or a combination thereof, or a pharmaceuticallyacceptable salt thereof. In one embodiment, such metabolites maycomprise ospemifene, fispemifene or their combination. In oneembodiment, the cancer is is prostate cancer.

A person skilled in the art would readily recognize that changes inthe antineoplastic therapy according to the methods providedherein, utilizing the compositions provided herein may be conductedas a function of, or adjusted or varied as a function of,inter-alia, the severity of the underlying disease, the source ofthe underlying disease, the extent of the patients' pain and sourceof the patients' pain, as well as the stage of the disease. Thetherapeutic changes may include in certain embodiments, changes inthe route of administration (e.g. intracavitarily, intraartiarly,intratumorally etc.), forms of the compositions administered (e.g.tablets, elixirs, suspensions etc.), changes in dosage and thelike. Each of these changes are well recognized in the art and areencompassed by the embodiments provided herein.

In males, while the natural decline in sex-hormones at maturity(direct decline in androgens as well as lower levels of estrogensderived from peripheral aromatization of androgens) is associatedwith the frailty of bones, this effect is more pronounced in maleswho have undergone androgen deprivation therapy.

Such agents for combined use may comprise a SERM, as hereindescribed, a bisphosphonate, for example, alendronate, tiludroate,clodroniate, pamidronate, etidronate, alendronate, zolendronate,cimadronate, neridronate, minodronic acid, ibandronate,risedronate, hom*oresidronate; a calcitonin, for example, salmon,Elcatonin.RTM., SUN-8577, TJN-135; a vitamin D or derivative(ZK-156979); a vitamin D receptor ligand or analogues thereof, suchas calcitriol, topitriol ZK-150123, TEI-9647, BXL-628, Ro-26-9228,BAL-2299, Ro-65-2299, DP-035; an estrogen, estrogen derivative, orconjugated estrogen; an antiestrogen, progestin, syntheticestrogen/progestin; a RANK ligand mAb, for example, denosumab orAMG162 (Amgen); an .alpha.v.beta.3 integrin receptor antagonist; anosteoclast vacuolar ATPase inhibitor, an antagonist of VEGF bindingto osteoclast receptors, a calcium receptor antagonist, PTh(parathyroid hormone) or analogues thereof, PTHrP analogues(parathyroid hormone-related peptide), cathepsin K inhibitors(AAE581), strontium ranelate, tibolone; HCT-1026, PSK3471, galliummaltolate, Nutropin AQ.RTM., prostaglandins, p38 protein kinaseinhibitor, a bone morphogenetic protein, an inhibitor of BMPantagonism, an HMG-CoA reductase inhibitor, a vitamin K orderivative, an antiresorptive, an ipriflavone, a fluoride salt,dietary calcium supplement, osteoprotegerin, or any combinationthereof. In one embodiment, the combined administration of a SARMas herein described, osteoprotegerin and parathyroid hormone iscontemplated for treating any disease, disorder or condition of thebone.

In one embodiment, the immunomodulating agent is ananti-inflammatory agent. In one embodiment, the anti-inflammatoryagent is a non-steroidal anti-inflammatory agent. In oneembodiment, the non-steroidal anti-inflammatory agent is a Cox-1inhibitor. In one embodiment, the non-steroidal anti-inflammatoryagent is a Cox-2 inhibitor. In one embodiment, the non-steroidalanti-inflammatory agent is a Cox-1 and Cox-2 inhibitor. In someembodiments, non-steroidal anti-inflammatory agents include but arenot limited to aspirin, salsalate, diflunisal, ibuprofen,fenoprofen, flurbiprofen, fenamate, ketoprofen, nabumetone,piroxicam, naproxen, diclofenac, indomethacin, sulindac, tolmetin,etodolac, ketorolac, oxaprozin, or celecoxib. In one embodiment,the anti-inflammatory agent is a steroidal anti-inflammatory agent.In one embodiment, the steroidal anti-inflammatory agent is acorticosteroid.

In one embodiment, the immunomodulating agent is an anti-rheumaticagent. In one embodiment, the anti-rheumatic agent is anon-steroidal anti-inflammatory agent. In one embodiment, theanti-rheumatic agent is a corticosteroid. In one embodiment, thecorticosteroid is prednisone or dexamethasone. In one embodiment,the anti-rheumatic agent is a disease modifying anti-rheumaticdrug. In one embodiment, the disease modifying anti-rheumatic drugis a slow-acting anti-rheumatic drug. In one embodiment, thedisease modifying anti-rheumatic drug is an antimalarial agent. Inone embodiment, disease modifying anti-rheumatic drugs include butare not limited to chloroquine, hydroxychloroquine, methotrexate,sulfasalazine, cyclosporine, azathioprine, cyclophosphamide,azathioprine, sulfasalazine, penicillamine, aurothioglucose, goldsodium thiomalate, or auranofin. In one embodiment, theanti-rheumatic agent is an immunosuppressive cytotoxic drug. In oneembodiment, immunosuppressive cytotoxic drugs include but are notlimited to methotrexate, mechlorethamine, cyclophosphamide,chlorambucil, or azathioprine.

In one embodiment, the SARM compound of this invention isadministered in combination with an antidiabetic agent. In oneembodiment, the antidiabetic agent is a sulfonylurea. In oneembodiment, sulfonylureas include but are not limited totolbutamide, acetohexamide, tolazamide, chlorpropamide, glipizide,glyburide, glimepiride, or gliclazide. In one embodiment, theantidiabetic agent is a meglitinide. In one embodiment,meglitinides include but are not limited to prandin or nateglinide.In one embodiment, the antidiabetic agent is a biguanide. In oneembodiment, biguanides include but are not limited to metformin. Inone embodiment, the antidiabetic agent is a thiazolidinedione. Inone embodiment, thiazolidinediones include but are not limited torosiglitazone, pioglitazone, or troglitazone. In one embodiment,the antidiabetic agent is an alpha glucosidase inhibitor. In oneembodiment, alpha glucosidase inhibitors include but are notlimited to miglitol or acarbose. In one embodiment, theantidiabetic agent is PPAR.alpha./.gamma. ligand,dipeptidylpeptidase 4 (DPP-4) inhibitor, SGLT (sodium-dependentglucose transporter 1) inhibitor, or FBPase (fructose1,6-bisphosphatase) inhibitor. In one embodiment, the antidiabeticagent is insulin. In one embodiment, the insulin is rapid-actinginsulin. In one embodiment, the insulin is short-acting insulin. Inone embodiment, the insulin is intermediate-acting insulin. In oneembodiment, the insulin is intermediate- and short-acting insulinmixtures. In one embodiment, the insulin is long-acting insulin. Inone embodiment, the antidiabetic agents are inhibitors of fattyacid binding protein (aP2) such as those disclosed in U.S. Ser. No.09/519,079 filed Mar. 6, 2000, glucagon-like peptide-1 (GLP-1), anddipeptidyl peptidase IV (DPP4) inhibitors such as those disclosedin WO 0168603, which are incorporated by reference.

In one embodiment, the SARM compound of this invention isadministered in combination with an agent treating the nervoussystem. In one embodiment, the agent treating the nervous system isan agent treating the autonomic nervous system. In one embodiment,the agent treating the autonomic nervous system is an adrenomimeticdrug. In one embodiment, the adrenomimetic drug is abeta-adrenoceptor agonist, alpha-adrenoceptor agonist, or acombination thereof. In one embodiment, the adrenomimetic drug is acatecholamine. In one embodiment, adrenomimetic drugs include butare not limited to isoproterenol, norepinephrine, epinephrine,amphetamine, ephedrine, or dopamine. In one embodiment, theadrenomimetic drug is a directly acting adrenomimetic drug. In someembodiments, directly acting adrenomimetic drugs include but arenot limited to phenylephrine, metaraminol, or methoxamine.

In one embodiment, the agent treating the autonomic nervous systemis an adrenoceptor antagonist. In one embodiment, the adrenoceptorantagonist is a haloalkylamine, imidazoline, or quinazoline. In oneembodiment, haloalkylamines include but are not limited tophenoxybenzamine. In one embodiment, imidazolines include but arenot limited to phentolamine or tolazoline. In one embodiment,quinazolines include but are not limited to prazosin, terazosin,doxazosin, or trimazosin. In one embodiment, the adrenoceptorantagonist has a combined alpha and beta blocking activity. In oneembodiment, the combined alpha and beta blocking agent islabetalol, bucindolol, carvedilol, or medroxalol.

In one embodiment, the agent treating the autonomic nervous systemis a cholinomimetic agent. In one embodiment, the cholinomimeticagent is a direct-acting parasympathomimetic drug. In oneembodiment, direct-acting parasympathomimetic drugs include but arenot limited to methacholine, pilocarpine, carbachol, orbethanechol.

In one embodiment, the agent treating the autonomic nervous systemis a cholinesterase inhibitor. In one embodiment, thecholinesterase inhibitor is a quaternary ammonium agent. In oneembodiment, quaternary ammonium agents include but are not limitedto edrophonium or ambenonium. In one embodiment, the cholinesteraseinhibitor is a carbamate such as physostigmine, pyridostigmine,neostigmine, or rivastigmine. In one embodiment, the cholinesteraseinhibitor is an organophosphate agent. In one embodiment, theinhibitor targets acetylcholine in the central nervous system suchas tacrine, donepezil, or galanthamine.

In one embodiment, the agent treating the autonomic nervous systemis a muscarinic blocking agent. In one embodiment, the muscarinicblocking agent is a belladonna alkaloid such as atropine orscopolamine.

In one embodiment, the agent treating the autonomic nervous systemis a ganglionic blocking agent. In one embodiment, ganglionicblocking agents include but are not limited to nicotine,trimethaphan, or mecamylamine.

In one embodiment, the agent treating the nervous system is anagent treating the central nervous system. In one embodiment, theagent treating the central nervous system is a local anestheticagent. In one embodiment, local anesthetic agents include but arenot limited to benzocaine, chloroprocaine, cocaine, procaine,bupivacaine, levobupivacaine, lidocaine, mepivacaine, prilocaine,or ropivacaine. In one embodiment, the agent treating the centralnervous system is a general anaesthetic agent. In one embodiment,general anesthetic agents include but are not limited to esflurane,sevoflurane, isoflurane, halothane, enflurane, methoxyflurane,xenon, propofol, etomidate, methohexital, midazolam, diazepamor,ketamine, thiopentone/thiopental, or lidocaine/prilocaine.

In one embodiment, the agent treating the central nervous system isan analgesic agent. In some embodiments, analgesic agents includebut are not limited to paracetamol or non-steroidalanti-inflammatory agent. In some embodiments, analgesic agentsinclude opiates or morphinomimetics such as morphine, pethidine,oxycodone, hydrocodone, diamorphine, tramadol, or buprenorphine. Insome embodiments, a combination of two or more analgesics isdesired.

In one embodiment, the agent treating the central nervous system isa muscle relaxant or vasoconstrictor agent. In one embodiment,muscle relaxants include but are not limited to methocarbamol,baclofen, carisoprodol, chlorzoxazone, cyclobenzaprine, dantrolene,metaxalone, orphenadrine, amyl nitrite, pancuronium, tizanidine,clonidine, or gabapentin. In one embodiment, vasoconstrictor agentsinclude but are not limited to antihistamines, adrenalindimethylarginine, caffeine, cannabis, catecholamines,decongestants, pseudoephedrinse, norepinephrines, tetrahydrozoline,or thromboxane.

In one embodiment, the agent treating the central nervous system isan antiemetic drug. In one embodiment, the antiemetic drug is a5-HT.sub.3 receptor antagonist such as dolasetron, granisetron,ondansetron, or tropisetron. In one embodiment, the antiemetic drugis a dopamine antagonist such as domperidone droperidol,haloperidol, chlorpromazine, promethazine, or metoclopramide. Inone embodiment, the antiemetic drug is an antihistamine such ascyclizine, diphenhydramine, dimenhydrinate, or meclizine. In oneembodiment, the antiemetic drug is a cannabinoid such as cannabisor marinol.

In one embodiment, the agent treating the central nervous system isa sedative agent. In one embodiment, the sedative agent is anantidepressant agent such as mirtazapine or trazodone. In oneembodiment, the sedative agent is a barbiturate such assecobarbital, pentoberbital, or amobarbital. In one embodiment, thesedative agent is a benzodiazepine such as diazepam, clonazepam,alprazolam, temazepam, chlordiazepoxide, flunitrazepam, lorazepam,or clorazepate. In one embodiment, the sedative agent is animidazopyridines such as zolpidem or alpidem. In one embodiment,the sedative agent is a pyrazolopyrimidine such as zaleplon. In oneembodiment, the sedative agent is an antihistamine such asdiphenhydramine, dimenhydrinate, or doxylamine. In one embodiment,the sedative agent is an antipsychotic agent such as ziprasidone,risperidone, quetiapine, clozapine, prochlorperazine, perphenazine,loxapine, trifluoperazine, thiothixene, haloperidol, orfluphenazine. In one embodiment, the sedative agent is an herbalsedative such as valerian plant mandrake, or kava. In someembodiments, the sedative agent is eszopiclone, ramelteon,methaqualone, ethchlorvynol, chloral hydrate, meprobamate,glutethimide, methyprylon, gamma-hydroxybutyrate, ethyl alcohol,methyl trichloride, zopiclone, or diethyl ether.

In one embodiment, the agent treating the central nervous system isa neurodegenerative disorder medication. In one embodiment, theneurodegenerative disorder medication is an acetylcholinesteraseinhibitor such as tacrine, donepezil, galanthamine, orrivastigmine. In one embodiment, the neurodegenerative disordermedication is an N-methyl-D-aspartate (NMDA) antagonist such asmemantine. In one embodiment, the neurodegenerative disordermedication reduces damage to motor neurons such as riluzole. In oneembodiment, the neurodegenerative disorder medication silences thegene that causes the progression of the disease. In one embodiment,the agent treating the central nervous system is an antiepilepticdrug (AED). In some embodiments, antiepileptic agents includesodium channel blockers, GABA receptor agonists, GABA reuptakeinhibitors, GABA transaminase inhibitor, AEDs with a potential GABAmechanism of action, glutamate blockers, or AEDs with othermechanisms of action. In some embodiments, antiepileptic agentsinclude but are not limited to carbamazepine, fosphenytoin,oxcarbazepine, lamotrigine, zonisamide, clobazam, clonazepam,phenobarbital, primidone, tiagabine, vigabatrin, gabapentin,valproate, felbamate, topiramate, levetiracetam, or pregabalin.

In one embodiment, the agent treating the central nervous system isan anti-addiction drug. In one embodiment, the anti-addiction is ananti-alcoholism drug such as disulfiram. In one embodiment, theanti-addiction drug is a serotonin uptake inhibitor, dopaminergicagonist, or opioid antagonist.

In one embodiment, the agent treating the central nervous system isan agent treating Alzheimer's disease. In some embodiments, agentstreating Alzheimer's disease include but are not limited to acholinesterase inhibitor, gamma secretase inhibitor, or an A-betalowering drug.

In one embodiment, the agent treating the central nervous system isan agent treating mild cognitive impairment. In some embodiments,agents treating mild cognitive impairment include but are notlimited to an AMPA regulator.

In one embodiment, the agent treating the central nervous system isan agent treating Parkinson's disease. In some embodiments, agentstreating Parkinson's disease include but are not limited to adopaminergic drugs, amantadine, benztropine, biperiden,bromocriptine, entacapone, carbidopa/levodopa, selegiline/deprenyl,diphenhydramine, pergolide, procyclidine, selegiline, ortrihexyphenidyl.

In one embodiment, the SARM compound of this invention isadministered with an agent, which treats Alzheimer's disease, suchas cholinesterase inhibitors, gamma secretase inhibitors, or A-betalowering drugs; or an agent, which treats mild cognitive impairment(MCI)--such as AMPA regulators, or an agent, which treatsParkinson's disease, such as dopaminergic drugs, or an agent, whichtreats major depression, such as SSRI's, SNRI's, for example,duloxetine, or an agent, which treats sexual dysfunction, such asPDE5 inhibitors.

In one embodiment, the SARM compound of this invention isadministered in combination with an agent treating thecardiovascular system. In one embodiment, the agent treating thecardiovascular system is treating a congestive heart failure. Inone embodiment, the agent treating congestive heart failure is anangiotensin converting enzyme (ACE) inhibitor such as benazepril,captopril, cilazapril, enalapril, fosinopril, lisinopril,moexipril, perindopril, quinapril, ramipril, trandolapril, orenalaprilat. In one embodiment, the agent treating congestive heartfailure is a beta-blocker such as acebutolol, atenolol betaxololhydrochloride, bisoprolol fumarate, carteolol hydrochloride,carvedilol, celiprolol hydrochloride, esmolol hydrochloride,labetalol hydrochloride, levobunolol, metoprolol tartrate,metipranolol, nadolol, nebivolol, oxprenolol hydrochloride,pindolol propranolol hydrochloride, sotalol hydrochloride, ortimolol maleate. In one embodiment, the agent treating congestiveheart failure is digoxin. In one embodiment, the agent treatingcongestive heart failure is a diuretic such as thiazide diuretic,loop diuretic, potassium-sparing diuretic, or a combinationthereof. In some embodiments, thiazide diuretics include but arenot limited to bendrofluazide, bendroflumethiazide, benzthiazide,chlorothiazide, chlorthalidone, cyclopenthiazide, Diucardin.RTM.,Diuril.RTM., Enduron.RTM., Esidrix.RTM., Exna.RTM., HCTZ,hydrochlorothiazide, Hydrodiuril.RTM., hydroflumethiazide,Hydromox.RTM., Hygroton.RTM., indapamide, Lozol.RTM.,methylclothiazide, metolazone, Mykrox.RTM., Naqua.RTM.,Naturetin.RTM., Oretic.RTM., polythiazide, quinethazone,Renese.RTM., trichloromethiazide, xipamide, or Zaroxolyn.RTM.. Insome embodiments, loop diuretics include but are not limited tofurosemide, bumetanide, or torsemide. In some embodiments,potassium-sparing diuretics include but are not limited toamiloride, triamterene, aldosterone antagonists, orspironolactone.

In one embodiment, the agent treating the cardiovascular system isan anti-arrhythmic agent. In one embodiment, the anti-arrhythmicagent is a sodium channel blocker, beta-adrenergic blocker, calciumchannel blocker, or an agent that prolongs repolarization. In oneembodiment, sodium channel blockers include but are not limited toquinidine, procainamide, disopyramide, lidocaine, tocainide,mexiletine, encainide, or flecainide. In one embodiment,beta-adrenergic blockers include but are not limited topropranolol, acebutolol esmolol, or sotalol. In one embodiment,agents that prolong repolarization include but are not limited tosotalol or amiodarone. In one embodiment, calcium channel blockersinclude but are not limited to verapamil, diltiazem, nifedipine, ormebefradil. In one embodiment, the anti-arrhythmic agent isadenosine or digoxin.

In one embodiment, the agent treating the cardiovascular system isan anti-anginal agent. In one embodiment, the anti-anginal agent isan antiplatelet agent, adrenoceptor antagonist, calcium channelblocker, or a vasodilator. In some embodiments, the adrenoceptorantagonists and calcium channel blockers comprise agents asdescribed hereinabove. In one embodiment, the antiplatelet agent isa cyclooxygenase inhibitor, ADP inhibitor, phosphodiesterase IIIinhibitor, glycoprotein IIb/IIIa inhibitor, or an adenosinereuptake inhibitor. In one embodiment, cyclooxygenase inhibitorsinclude but are not limited to acetylsalicylic acid or anacetylsalicylic acid in combination with dipyridimole. In oneembodiment, ADP inhibitors include but are not limited toclopidogrel, CS-747, or ticlopdipine. In one embodiment,phosphodiesterase III inhibitors include but are not limited tocilostazol. In one embodiment, glycoprotein IIb/IIIa inhibitorsinclude but are not limited to abciximab, Rheopro.RTM.,eptifibatide, integrilin, tirofiban, or Aggrastat.RTM.. In oneembodiment, adenosine reuptake inhibitors include but are notlimited to dipyridimole. In one embodiment, vasodilator agentsinclude but are not limited to isosorbide dinitrate, isosorbidemononitrate, or nitroglycerin. In one embodiment, cardiacglycosides such as digitalis or ouabain may be used in combinationwith a SARM compound.

In one embodiment, the agent treating the cardiovascular system isa vasoactive agent or an inotrope. In one embodiment, vasoactiveagents or inotropes include but are not limited to digoxin,dopamine, dobutamine, hydralazine, prazosin, carvedilol,nitroprusside, nitroglycerin, captopril, lisinopril, nifedipine,diltiazem, hydrochlorothiazide, furosemide, spironolactone, AT-1receptor antagonists (e.g., losartan, irbesartan, valsartan), ETreceptor antagonists (e.g., sitaxsentan, atrsentan and compoundsdisclosed in U.S. Pat. Nos. 5,612,359 and 6,043,265), dual ET/AIIantagonist (e.g., compounds disclosed in WO 00/01389), neutralendopeptidase (NEP) inhibitors, vasopepsidase inhibitors (dualNEP-ACE inhibitors) (e.g., omapatrilat and gemopatrilat), ornitrates.

In one embodiment, the agent treating the cardiovascular system isan anticoagulant agent. In one embodiment, the anticoagulant agentis a coumarin derivative or an unfractionated heparin. In oneembodiment, coumarin derivatives include but are not limited towarfarin.

In one embodiment, the agent treating the cardiovascular system isa fibrinolytic agent such as streptokinase, urokinase, alteplase,anistreplase, prourokinase, reteplase, tenecteplase, lanoteplase,staphylokinase, vampire, or alfimeprase.

In one embodiment, the agent treating the cardiovascular system isa hypercholesterolemic agent such as niacin-lovastatin, colestipolHCl, fluvastatin sodium, atorvastatin calcium, simvastatin,gemfibrozil, lovastatin, pravastatin sodium, cholestyramine,cholestyramine light, fenofibrate, colesevelam HCl, orezetimibe.

In one embodiment, the SARM compound of this invention isadministered in combination with an agent treating thegastrointestinal system. In one embodiment, the agent treating thegastrointestinal (GI) system is enhancing GI motility. In oneembodiment, the agent enhancing GI motility is a prokinetic agentsuch as metoclopramide, cisapride, tegaserod, or erythromycin. Inone embodiment, the agent treating the GI system is decreasing GImotility. In one embodiment, the agent decreasing GI motility is anopioid such as morphine, diphenoxylate, loperamide hydrochloride,or opium.

In one embodiment, the agent treating the GI system is an adsorbentor a bulking agent. In one embodiment, the adsorbent is kaolin orother hydrated aluminum silicate clays. In one embodiment, thehydrated aluminum silicate clay is further combined with pectin. Inone embodiment, adsorbents or bulking agents comprise bismuthsubsalicylate, methylcellulose, psyllium derivative, or calciumpolycarbophil.

In one embodiment, the agent treating the GI system is a stoolsoftener. In one embodiment, stool softeners include but are notlimited to mineral oil, docusate dioctyl sodium sulfosuccinate,dioctyl calcium sulfosuccinate, or dioctyl potassiumsulfosuccinate.

In one embodiment, the agent treating the GI system is a laxative.In one embodiment, the agent treating the GI system is a bulkforming laxative as described hereinabove. In one embodiment, thelaxative is an osmotic laxative such as lactulose, sorbitol, orpolyethylene glycol. In one embodiment, the laxative is a salinelaxative such as milk of magnesia, magnesium citrate, sodiumphosphate, docusate potassium, sorbitol, sodiumphosphate-biphosphate, or visicol.

In one embodiment, the agent treating the GI system is a catharticstimulant. In one embodiment, the cathartic stimulant is ananthraquinone derivative such as cascara, aloe, senna, or rhubarb.In one embodiment, the cathartic stimulant is phenolphthalein,castor oil, or bisacodyl.

In one embodiment, the agent treating the GI system is an emeticagent. In one embodiment, the emetic agent is ipecac orapomorphine. In one embodiment, the agent treating the GI system isan anti-emetic agent such as antihistamine, anti-cholinergic agent,benzodiazepine, cannabinoid, dopamine antagonist, phenothiazinederivative, or 5-HT.sub.3 antagonist such as ondansetron orgranisetron.

In one embodiment, the agent treating the GI system is an antacid.In one embodiment the antacid pharmaceutical preparation comprisesbuffering agents such as sodium bicarbonate, calcium carbonate,magnesium hydroxide, or aluminum hydroxide.

In one embodiment, the agent treating the GI system is anH.sub.2-receptor antagonist. In some embodiments, theH.sub.2-receptor antagonist is cimetidine, ranitidine, famotidine,or nizatidine.

In one embodiment, the agent treating the GI system is a protonpump inhibitor. In some embodiments, the proton pump inhibitor isomeprazole, lansoprazole, pantoprazole, rebeprazole, oresomeprazole

In one embodiment, the agent treating the GI system is an agenttreating inflammation. In one embodiment, the agent treatinginflammation is 5-amino-salicylate, corticosteroid, metronidazole,ciprofloxacin, infliximab, budesonide, or anti-TNF alphaantibody.

In one embodiment, the SARM compound of this invention isadministered in combination with an agent treating a metabolicdisease, disorder or condition, which in some embodiments refers tometabolic syndrome. In some embodiments, such agents comprise,inter alia, pancreatic lipase inhibitors, such as for example,orlistat, cetilistat; serotonin and norepinephrine reuptakeinhibitors, such as sibutramine; insulin-sensitizers such asbiguanides (metformin) or PPAR agonists, dual-acting PPAR agonists(muraglitazar, tesaglitazar, naveglitazar), PPAR-delta agonists(GW-501516), DPP-IV inhibitors (vildagliptin, sitagliptin), alphaglucosidase inhibitors (acarbose), anti-diabetic combinations(ActoPlusMet.RTM., AvandaMet.RTM., metformin/pioglitazone,metformin/rosiglitazone, Glucovance.RTM., etc.), glucagon-likepeptide-1 analogues (exenatide, liraglutide), amylin analogues(pramlintide), statins (atorvastatin, simvastatin, rosuvastatin,pravastatin, fluvastatin, lovastatin, pitavastatin), cholesterolabsorption inhibitors (ezetimibe), nicotinic acid derivatives(immediate release and controlled release niacins, Niaslo.RTM.,etc.), antidyslipidemic fixed combinations (simvastatin/ezetimibe,lovastatin/nicotinic acid, atorvastatin/amlodipine,atorvastatin/torcetrapib, simvastatin/nicotinic acid (ER)), ACEinhibitors (ramipril, captopril, lisinopril), AT-II receptorantagonists (valsartan, telmisartan), cannabinoid receptorantagonists (rimonabant), cholesteryl ester transfer protein orCETP inhibitors (anacetrapib, JTT-705, CETi-1), beta3 adrenergicagonists, PPAR.alpha. ligands, or combinations thereof.

In one embodiment, the SARM compound of this invention isadministered in combination with an agent treating a dermatologicaldisorder. In one embodiment, the agent treating a dermatologicaldisorder is a corticosteroid or glucocorticosteroid such asbetamethasone dipropionate, clobetasol, diflorasone, amcinonide,desoximetasone, fluocinonide, aclometasone, desonide triamcinolone,fluticasone, halobetasol, mometasone, or hydrocortisone. In oneembodiment, the agent treating a dermatological disorder is aretinoid such as isotretinoin, acitretin, tretinoin, adapalene,tazarotene, bexarotene, alitretinoin, or beta-carotene.

In one embodiment, the agent treating a dermatological disorder isphotochemotherapy agent. In one embodiment, the photochemotherapyagent is PUVA or psoralen such as oxsoralen. In one embodiment, theagent treating a dermatological disorder is a photodynamic agentsuch as porphyrin.

In one embodiment, the agent treating a dermatological disorder isdapsone, thalidomide, anti-malarial agent, antimicrobial agent, orantifungal agent. In one embodiment, the anti-malarial agent ischloroquine or hydroxychloroquine.

In one embodiment, the agent treating a dermatological disorder isan antibiotic. In one embodiment, the antibiotic is a systemicantibiotic such as griseofulvin, ketoconazole, fluconazole,itraconazole, terbinafine, or potassium iodide. In one embodiment,the antibiotic is a topical antifungal agent. In some embodiment,topical antifungal agents include but are not limited tociclopirox, clotrimazole, econazole, ketoconazole, miconazole,naftifine, oxiconazole, terbinafine, or tolnaftate.

In one embodiment, the agent treating a dermatological disorder isan antiviral agent such as interferon alpha. In one embodiment, theagent treating a dermatological disorder is an antiscabies agentsuch as pyrethrin or pyrethroid. In one embodiment, the agenttreating a dermatological disorder is an immunosuppressive agentsuch as mycophenolate motefil or 6-thioguanine. In one embodiment,the agent treating a dermatological disorder is a topicalimmunosuppressive agent such as tacrolimus, pimecrolimus,imiquimod, 5-fluorouracil, or mechlorethamine. In one embodiment,the agent treating a dermatological disorder is an antihistaminesuch as doxepin. In one embodiment, the agent treating adermatological disorder is treating pigmentation such ashydroquinone or monobenzone. In one embodiment, the agent treatinga dermatological disorder is a protein or a recombinant proteinsuch as becaplermin, etanercept, denileukin diftitox, or botulinumtoxin. In one embodiment, the agent treating a dermatologicaldisorder is capsaicin, anthralin, benzoyl peroxide, orcalcipotriene.

In one embodiment, the agent treating a dermatological disorder isa keratolytic agent. In one embodiment, the agent treating adermatological disorder is selenium sulfide. In one embodiment, theagent treating or preventing a dermatological disorder is asunscreen. In one embodiment, the sunscreen absorbs UVB, UVA, or acombination thereof.

In one embodiment, the agent treating a dermatological disorder maybe a growth factor such as epidermal growth factor (EGF),transforming growth factor-.alpha. (TGF-.alpha.), platelet derivedgrowth factor (PDGF), fibroblast growth factors (FGFs) includingacidic fibroblast growth factor (.alpha.-FGF) and basic fibroblastgrowth factor (.beta.-FGF), transforming growth factor-.beta.(TGF-.beta.) and insulin like growth factors (IGF-1 and IGF-2), orany combination thereof.

In one embodiment, the SARM compound of this invention isadministered in combination with an anti-infective agent. In oneembodiment, the anti-infective agent is an antibiotic agent. In oneembodiment the antibiotic is a beta-lactam antibiotic. In oneembodiment beta-lactam antibiotics include but are not limited topenicillin, benzathine penicillin, benzylpenicillin, amoxicillin,procaine penicillin, dicloxacillin, amoxicillin, flucloxacillin,ampicillin, methicillin, azlocillin, carbenicillin, ticarcillin,mezocillin, piperacillin, phenoxymethylpenicillin,Co-Amoxiclav.RTM., cephalosporin, cefalexin, cephalothin,cefazolin, cefaclor, cefuroxime, cefamandole, cefotetan, cefoxitin,ceftriaxone, cefotaxime, ceftazidime, cefepime, cefpirome,imipenem, meropenem, ertapenem, faropenem, monobactam, aztreonam,or carbapenem.

In one embodiment the antibiotic is a tetracycline antibiotic. Inone embodiment tetracycline antibiotics include but are not limitedto tetracycline, chlortetracycline, demeclocycline, doxycycline,lymecycline, minocycline, or oxytetracycline.

In one embodiment the antibiotic is a macrolide antibiotic. In oneembodiment macrolide antibiotics include but are not limited toerythromycin, azithromycin, oxithromycin, dirithromycin,clarithromycin, josamycin, oleandomycin, kitasamycin, spiramycin,tylosin/tylocine, troleandomycin, carbomycin, cethromycin, ortelithromycin.

In one embodiment the antibiotic is an aminoglycoside antibiotic.In one embodiment, aminoglycoside antibiotics include but are notlimited to gentamicin, tobramycin, faropenem, imipenem, kanamycin,neomycin, ertapenem, apramycin, paromomycin sulfate, streptomycin,or amikacin.

In one embodiment the antibiotic is a quinolone antibiotic. In oneembodiment quinolone antibiotics include but are not limited tociprofloxacin, norfloxacin, lomefloxacin, enoxacin, ofloxacin,ciprofloxacin, levofloxacin, sparfloxacin, gatifloxacin,moxifloxacin, trovafloxacin, or alatrofloxacin.

In one embodiment the antibiotic is a cyclic peptide antibiotic. Inone embodiment cyclic peptide antibiotics include but are notlimited to vancomycin, streptogramins, Microcin J25.RTM.,Bacteriocin AS-48.RTM., RTD-1, or polymyxins.

In one embodiment the antibiotic is a lincosamide antibiotic. Inone embodiment lincosamide antibiotics include but are not limitedto clindamycin.

In one embodiment, the antibiotic is an oxazolidinone antibiotic.In one embodiment oxazolidinone antibiotics include but are notlimited to linezolid, U-100592, DA-7867, AZD2563, or U-100766.

In one embodiment, the antibiotic is a sulfa antibiotic. In oneembodiment, sulfa antibiotics include but are not limited tosulfisoxazole.

In one embodiment, the antibiotic is an antiseptic agent. In oneembodiment, antiseptic agents include but are not limited toalcohols, chlorhexidine, chlorine, hexachlorophene, iodophors,chloroxylenol (PCMX), quaternary ammonium compounds, ortriclosan.

In one embodiment, the antibiotic is an anti-tuberculosis agent. Inone embodiment an anti-tuberculosis agents include but are notlimited to ethambutol, rifabutin, isoniazid, rifampicin,pyrazinamide, or rifampin

In one embodiment, the antibiotic is an antifungal agent. In oneembodiment, antifungal agents include but are not limited toterbinafine, flucytosine, fluconazole, itraconazole, ketoconazole,ravuconazole, posaconazole, voriconazole, caspofungin, micafungin,v-echinocandin, amphotericin B, amphotericin B lipid complex(ABLC), amphotericin B colloidal dispersion (ABCD), liposomalamphotericin b (1-Amb), liposomal nystatin, or griseofulvin.

In one embodiment, the antibiotic is an antiprotozoal agent. In oneembodiment the antiprotozoal agent is an antimalarial agent. In oneembodiment, antimalarial agents include but are not limited tochloroquine, mefloquine, proguanil, pyrimethamine with dapsone,pyrimethamine with sulfadoxine, quinine, or primaquine. In oneembodiment, the antiprotozoal agent is an amoebicide. In oneembodiment, amoebicides include but are not limited tometronidazole, tinidazole, or diloxanide furoate. In oneembodiment, the antiprotozoal agent is an antigiardial agent. Inone embodiment, antigiardial agents include but are not limited tometronidazole, tinidazole, or mepacrine. In one embodiment, theantiprotozoal agent is a leishmanicide. In one embodiment,leishmanicides include but are not limited to sodiumstibogluconate. In one embodiment, the antibiotic is ananthelmintic agent.

In one embodiment, the antibiotic is an antiviral agent. In oneembodiment, antiviral agents include but are not limited toabacavir, acyclovir, amantadine, didanosine, entricitabine,enfuvirtide, entecavir, lamivudine, nevirapine, oseltamivir,ribavirin, rimantadine, stavudine, valaciclovir, vidarabine,zalcitabine, or zidovudine. In one embodiment, the antiviral agentis a nucleotide analog reverse transcriptase inhibitor. In oneembodiment, nucleotide analog reverse transcriptase inhibitorsinclude but are not limited totenofovir or adefovir. In oneembodiment, the antiviral agent is a protease inhibitor. In oneembodiment, protease inhibitors include but are not limited tosaquinavir, ritonavir, indinavir, nelfinavir, amprenavir,lopinavir, fosamprenavir, or tipranavir. In one embodiment, theantiviral agent is a fusion inhibitor such as enfuvirtide. In oneembodiment, a combination of antiviral or antiretroviral agents isdesired. In one embodiment, antiviral or antiretroviral agents or acombination thereof, further comprise hydroxyurea, resveratrol,grapefruit, ritonavir, leflunomide, or a combination thereof.

In one embodiment, the SARM compound of this invention isadministered in combination with an agent treating the liver. Inone embodiment, the SARM compound is administered in combinationwith a statin. In some embodiment, statins include but are notlimited to atorvastatin, fluvastatin, lovastatin, pravastatin,simvastatin, or rosuvastatin.

In one embodiment, the SARM compound of this invention isadministered in combination with a bile acid sequestrant. In someembodiment, bile acid sequestrants include but are not limited tocholestyramine, colestipol, or colesevelam.

In one embodiment, the SARM compound of this invention isadministered in combination with a cholesterol absorptioninhibitor. In some embodiment, cholesterol absorption inhibitorsinclude but are not limited to ezetimibe.

In one embodiment, the SARM compound of this invention isadministered in combination with a nicotinic acid agent. In someembodiments, nicotinic acid agents include but are not limited toniacin, niacor, or Slo-Niacin.RTM..

In one embodiment, the SARM compound of this invention isadministered in combination with a fibrate. In some embodiments,fibrates include but are not limited to gemfibrozil, orfenofibrate.

In one embodiment, the agent treating the liver is cortisone,cortisol or corticosterone. In some embodiments, the agent treatingthe liver is colchicine, methotrexate, ursodeoxycholic acid, orpenicillamine.

In one embodiment, the SARM compound of this invention isadministered in with an agent treating the kidney. In oneembodiment, the agent treating the kidney is a diuretic. In someembodiments, diuretics include but are not limited toorganomercurial, ethacrynic acid, furosemide, bumetanide,piretanide, muzolimine, chlorothiazide and thiazide, phthalimidine,chlorthalidone, clorexolone, quinazolinone, quinethazone,metolazone ilenzenesulphonamide, mefruside, chlorobenzamide,copamidesalicylamide, xipamide, xanthine, aminophylline, carbonicanhydrase inhibitor, acetazolamide mannitol, potassium-sparingcompound, aldosterone antagonist, spironolactone and canrenoate,pteridines, pyrazine, carboxamide-triamterene, or amiloride. In oneembodiment, the agent treating the kidney is a steroid.

In one embodiment, the agent treating the kidney is erythropoietin.In one embodiment, erythropoietin is obtained by natural sources(e.g., urinary erythropoietin; See U.S. Pat. No. 3,865,801), or isa recombinantly produced protein and analogs thereof, for example,as described in U.S. Pat. Nos. 5,441,868, 5,547,933, 5,618,698 and5,621,080 as well as human erythropoietin analogs with increasedglycosylation and/or changes in the amino acid sequence as thosedescribed in European Patent Publication No. EP 668351 and thehyperglycosylated analogs having 1-14 sialic acid groups andchanges in the amino acid sequence described in PCT Publication No.WO 91/05867. In one embodiment, erythropoietin-like polypeptidesare administered in combination with SARM compounds. In someembodiments, erythropoietin-like polypeptides comprise darbepoietin(from Amgen, also known as Aranesp.RTM. and novel erthyropoiesisstimulating protein (NESP)).

In one embodiment, the SARM compound of this invention isadministered in with an agent treating a metabolic disease. In someembodiments, agents treating a metabolic disease include but arenot limited to a vitamin, coenzyme Q10, glucosidase alfa, sodiumbicarbonate, bisphosphonate, biotin, allopurinol, levodopa,diazepam, phenobarbital, haloperidol, folic acid, antioxidants,activators of cation channels haptoglobin, or carnitine.

In one embodiment, the agent treating a metabolic disease is apancreatic lipase inhibitor such as orlistat or cetilistat,serotonin or norepinephrine reuptake inhibitor such as sibutramine,insulin-sensitizers such as biguanide, PPAR agonist, dual-actingPPAR agonist such as muraglitazar, tesaglitazar, or naveglitazar,PPAR-delta agonist such as GW-501516, DPP-IV inhibitor such asvildagliptin or sitagliptin, alpha glucosidase inhibitor such asacarbose, anti-diabetic combination such as ActoPlusMet.RTM.,AvandaMet.RTM., metformin/pioglitazone, metformin/rosiglitazone, orGlucovance.RTM., glucagon-like peptide-1 analogue such as exenatideor liraglutide, amylin analogue such as pramlintide, statin such asatorvastatin, simvastatin, rosuvastatin, pravastatin, fluvastatin,lovastatin, or pitavastatin, cholesterol absorption inhibitor suchas ezetimibe, nicotinic acid derivative such as niacin orNiaslo.RTM., antidyslipidemic fixed combination such assimvastatin/ezetimibe, lovastatin/nicotinic acid,atorvastatin/amlodipine, or atorvastatin/torcetrapib,simvastatin/nicotinic acid. ACE inhibitor such as ramipril,captopril, or lisinopril, AT-II receptor antagonist such asvalsartan or telmisartan, cannabinoid receptor antagonist such asrimonabant, cholesteryl ester transfer protein (CETP) inhibitorsuch as anacetripib, JTT-705, CETi-1, or beta-3 adrenergicagonist.

In one embodiment, the SARM compound of this invention isadministered with an agent treating a wasting disease. In someembodiments, agents treating a wasting disease include but are notlimited to corticosteroids, anabolic steroids, cannabinoids,metoclopramide, cisapride, medroxyprogesterone acetate, megestrolacetate, cyproheptadine, hydrazine sulfate, pentoxifylline,thalidomide, anticytokine antibodies, cytokine inhibitors,eicosapentaenoic acid, indomethacin, ibuprofen, melatonin, insulin,growth hormone, clenbuterol, porcine pancreas extract, IGF-1, IGF-1analogue and secretagogue, myostatin analogue, proteasomeinhibitor, testosterone, oxandrolone, etanercept (Enbrel.RTM.),melanocortin 4 receptor agonist, or a combination thereof.

In one embodiment, the agent treating a wasting disease is aghrelin receptor ligand, growth hormone analogue, or asecretagogue. In some embodiments, ghrelin receptor ligands, growthhormone analogues, or secretagogues include but are not limited topralmorelin, examorelin, tabimorelin, capimorelin, capromorelin,ipamorelin, EP-01572, EP-1572, or JMV-1843.

In one embodiment, growth promoting agents such as but not limitedto TRH, diethylstilbestrol, theophylline, enkephalins, E seriesprostaglandins, compounds disclosed in U.S. Pat. No. 3,239,345,e.g., zeranol, and compounds disclosed in U.S. Pat. No. 4,036,979,e.g., sulbenox or peptides disclosed in U.S. Pat. No. 4,411,890 areutilized as agents treating a wasting disease.

In other embodiments, agents treating a wasting disease maycomprise growth hormone secretagogues such as GHRP-6, GHRP-1 (asdescribed in U.S. Pat. No. 4,411,890 and publications WO 89/07110and WO 89/07111), GHRP-2 (as described in WO 93/04081), NN703 (NovoNordisk), LY444711 (Lilly), MK-677 (Merck), CP424391 (Pfizer) andB-HT920, or, in other embodiments, with growth hormone releasingfactor and its analogs or growth hormone and its analogs, or withalpha-adrenergic agonists, such as clonidine or serotinin5-HT.sub.D agonists, such as sumatriptan, or agents which inhibitsomatostatin or its release, such as physostigmine andpyridostigmine. In some embodiments, agents treating a wastingdisease may comprise parathyroid hormone, PTH(1-34) orbisphosphonates, such as MK-217 (alendronate). In otherembodiments, agents treating wasting disease may further compriseestrogen, a selective estrogen receptor modulator, such astamoxifen or raloxifene, or other androgen receptor modulators,such as those disclosed in Edwards, J. P. et al., Bio. Med. Chem.Let., 9, 1003-1008 (1999) and Hamann, L. G. et al., J. Med. Chem.,42, 210-212 (1999). In some embodiments, agents treating a wastingdisease may further comprise a progesterone receptor agonists("PRA"), such as levonorgestrel, medroxyprogesterone acetate (MPA).In some embodiments, agents treating a wasting disease may includenutritional supplements, such as those described in U.S. Pat. No.5,179,080, which, in other embodiments are in combination with wheyprotein or casein, amino acids (such as leucine, branched aminoacids and hydroxymethylbutyrate), triglycerides, vitamins (e.g., A,B6, B 12, folate, C, D and E), minerals (e.g., selenium, magnesium,zinc, chromium, calcium and potassium), carnitine, lipoic acid,creatinine, .beta.-hyroxy-.beta.-methylbutyrate (Juven.RTM.) andcoenzyme Q. In one embodiment, agents treating a wasting diseasemay further comprise antiresorptive agents, vitamin D analogues,elemental calcium and calcium supplements, cathepsin K inhibitors,MMP inhibitors, vitronectin receptor antagonists. Src SH2antagonists, vacuolar-H.sup.+-ATPase inhibitors, ipriflavone,fluoride, tibolone, prostanoids, 17-beta hydroxysteroiddehydrogenase inhibitors and Src kinase inhibitors.

In one embodiment, the SARM compound of this invention isadministered in with an agent treating the endocrine system. Insome embodiments, agents treating the endocrine system include butare not limited to radioactive iodine, antithyroid agent, thyroidhormone supplement, growth hormone, cabergoline, bromocriptine,thyroxine, gonadotropin, glucocorticoid, glucocorticoid analogue,corticotrophin, metyrapone, aminoglutethimide, mitotane,ketoconazole, mifepristone, dexamethasone somatostatin analogue,gonadotropin-releasing hormone analogue, leuprolide, goserelin,antidiuretic hormone, antidiuretic hormone analogue, oxytocin,calcium supplement, vitamin D, or a combination thereof.

In one embodiment, the agent treating the endocrine system is a5-alpha-reductase inhibitor. In some embodiments, 5-alpha-reductaseinhibitors include but are not limited to finasteride, dutasteride,or izonsteride.

In one embodiment, the agent treating the endocrine system is aSARM compound. In some embodiments, SARMs include but are notlimited to RU-58642, RU-56279, WS9761 A and B, RU-59063, RU-58841,bexlosteride, LG-2293, L-245976, LG-121071. LG-121091, LG-121104,LGD-2226, LGD-2941, YM-92088, YM-175735, LGD-1331, BMS-357597,BMS-391197, S-40503, BMS-482404, EM-4283, EM-4977, BMS-564929,BMS-391197, BMS-434588, BMS-487745, BMS-501949, SA-766, YM-92088,YM-580, LG-123303, LG-123129, PMCol, YM-175735, BMS-591305,BMS-591309, BMS-665139, BMS-665539, CE-590, 116BG33, 154BG31,arcarine, or ACP-105.

In one embodiment, the additional agent treating the endocrinesystem is a SERM compound. In some embodiments, SERMs include butare not limited to tamoxifene, 4-hydroxytamoxifene, idoxifene,toremifene, ospemifene, droloxifene, raloxifene, arzoxifene,bazedoxifene, PPT(1,3,5-tris(4-hydroxyphenyl)-4-propyl-1H-pyrazole), DPN,lasofoxifene, pipendoxifene, EM-800, EM-652, nafoxidine,zindoxifene, tesmilifene, miproxifene phosphate, RU 58,688, EM 139,ICI 164,384, ICI 182,780, clomiphene, MER-25, diethylstilbestrolcoumestrol, genistein, GW5638, LY353581, zuclomiphene,enclomiphene, delmadinone acetate, DPPE,(N,N-diethyl-2-[4-(phenylmethyl)-phenoxy]ethanamine), TSE-424,WAY-070, WAY-292, WAY-818, cyclocommunol, prinaberel, ERB-041,WAY-397, WAY-244, ERB-196, WAY-169122, MF-101, ERb-002, ERB-037,ERB-017. BE-1060, BE-380, BE-381, WAY-358, [.sup.18F]FEDNP,LSN-500307, AA-102, CT-101, CT-102, or VG-101.

In one embodiment, the agent treating the endocrine system is agonadotropin-releasing hormone agonist or antagonist. In someembodiments, gonadotropin-releasing hormone agonists or antagonistsinclude but are not limited to leuprolide, goserelin, triptorelin,alfaprostol, histrelin, detirelix, ganirelix, antide iturelix,cetrorelix, ramorelix, ganirelix, antarelix, teverelix, abarelix,ozarelix, sufugolix, prazarelix, degarelix, NBI-56418, TAK-810, oracyline.

In one embodiment, the agent treating the endocrine system is aluteinizing hormone agonist or antagonist. In some embodiments,luteinizing hormone agonists or antagonists include but are notlimited to letrozole, anastrazole, atamestane, fadrozole,minamestane, exemestane, plomestane, liarozole, NKS-01, vorozole,YM-511, finrozole, 4-hydroxyandrostenedione, aminogluethimide, orrogletimide. In one embodiment, the agent treating the endocrinesystem is a follicle stimulating hormone agonist or antagonist. Inone embodiment, the agent treating the endocrine system is aluteinizing hormone releasing hormone (LHRH) or a LHRH analog.

In one embodiment, the agent treating the endocrine system is asteroidal or to nonsteroidal glucocorticoid receptor ligand. Insome embodiments, nonsteroidal glucocorticoid receptor ligandsinclude but are not limited to ZK-216348, ZK-243149, ZK-243185,LGD-5552, mifepristone, RPR-106541, ORG-34517, GW-215864X,sesquicillin, CP-472555, CP-394531, A-222977, AL-438, A-216054,A-276575, CP-394531, CP-409069, or UGR-07.

In one embodiment, the agent treating the endocrine system is asteroidal or non-steroidal progesterone receptor ligand. In oneembodiment, the agent treating the endocrine system is a steroidalor nonsteroidal androgen receptor antagonist. In some embodiments,steroidal or nonsteroidal androgen receptor antagonists include butare not limited to flutamide, hydroxyflutamide, bicalutamide,enzalutamide, nilutamide, or hydroxysteroid dehydrogenaseinhibitor.

In one embodiment, the agent treating the endocrine system is aperoxisome proliferator-activated receptor ligand. In someembodiments, peroxisome proliferator-activated receptor ligandsinclude but are not limited to bezafibrate, fenofibrate,gemfibrozil, darglitazone, pioglitazone, rosiglitazone,isaglitazone, rivoglitazone, netoglitazone, naveglitazar,farglitazar, tesaglitazar, ragaglitazar, oxeglitazar, orPN-2034.

In one embodiment, an agent treating the endocrine system is ahuman growth hormone. In some embodiments, human growth hormonesinclude but are not limited to somatotropin or analogues.

In one embodiment, the agent treating the endocrine system is aghrelin. In some embodiments, ghrelins include but are not limitedto human ghrelin, CYT-009-GhrQb, L-692429, GHRP-6, SK&F-110679,or U-75799E.

In one embodiment, the agent treating the endocrine system is aleptin. In some embodiments, leptins include but are not limited tometreleptin or pegylated leptin. In one embodiment, an agenttreating the endocrine system is a leptin receptor agonist. In someembodiments, leptin receptor agonists include but are not limitedto LEP(116-130), OB3, [D-Leu4]-OB3, rAAV-leptin, AAV-hOB, orrAAVhOB.

In one embodiment, the SARM compound of this invention isadministered with an inhibitor of an enzyme involved in theandrogen biosynthetic pathway. In some embodiments, inhibitors ofenzymes involved in the androgen biosynthetic pathway include butare not limited to 17-ketoreductase inhibitor,3-.DELTA.H4,6-isomerase inhibitor, 3-.DELTA.H4,5-isomeraseinhibitor, 17,20 desmolase inhibitor, p450c17 inhibitor, p450sscinhibitor, or 17,20-lyase inhibitor.

In one embodiment, the SARM compound is administered with an agenttreating osteoporosis. In some embodiments, osteoporosis is inducedby alcohol and/or smoking. In some embodiments, agents treatingosteoporosis include but are not limited to SERMs, calcitonin,vitamin D, vitamin D derivatives, vitamin D receptor ligand,vitamin D receptor ligand analogue, estrogen, estrogen derivative,conjugated estrogen, antiestrogen, progestin, synthetic estrogen,synthetic progestin, RANK ligand monoclonal antibody, integrinreceptor antagonist, osteoclast vacuolar ATPase inhibitor,antagonist of VEGF binding to osteoclast receptors, calciumreceptor antagonist, parathyroid hormone, parathyroid hormoneanalogue, parathyroid hormone-related peptide, cathepsin Kinhibitor, strontium ranelate, tibolone, HCT-1026, PSK3471, galliummaltolate, Nutropin AQ.RTM., prostaglandin, p38 protein kinaseinhibitor, bone morphogenetic protein (BMP), inhibitor of BMPantagonism, HMG-CoA reductase inhibitor, vitamin K, vitamin Kderivative, ipriflavone, fluoride salts, dietary calciumsupplement, or osteoprotegerin.

In one embodiment, the agent treating osteoporosis is a calcitonin.In some embodiments, calcitonins include but are not limited tosalmon, elcatonin, SUN-8577, or TJN-135.

In one embodiment, the agent treating osteoporosis is a vitamin Dreceptor ligand or analogue. In some embodiments, vitamin Dreceptor ligands or analogues include but are not limited tocalcitriol, topitriol, ZK-150123, TEI-9647, BXL-628, Ro-26-9228,BAL-2299, Ro-65-2299, or DP-035.

In one embodiment, the SARM compound is administered with an agenttreating pharmacotherapy induced hypogonadal and/or osteopenicand/or sarcopenic state. In some embodiments, agents treatingpharmacotherapy induced hypogonadal and/or osteopenic and/orsarcopenic states include but are not limited to opioids,narcotics, opiates, opioids, methadone, Kadian.RTM., 12 dopaminereceptor antagonist, zotepine, haloperidol, amisulpride,risperidone, anti-epileptic agent, valproic acid, carbamazepine,oxcarbamazepine, chemotherapeutic agent, methotrexate,cyclophosphamide, ifosfamide, adriamycin, doxorubicin,glucocorticoids, cyclosporine, L-thyroxine, SERMs, aromataseinhibitors (AT), fulvestrant, gonadotropin-releasing hormone agent,androgen depravation agent, prolactinemia-inducing agent,serotonergic antidepressant, selective serotonin reuptakeinhibitor, monoamine oxidase inhibitor, tricyclic antidepressant,antihypertensive agents, methyldopa, reserpine, clonidine,verapamil, antidopaminergic agent, anti-emetic agent,metoclopramide, H.sub.2 receptor antagonist, cimetidine,ranitidine, estrogen, or amphetamine.

In one embodiment, the SARM compound is administered with avitamin. In some embodiments, vitamins include but are not limitedto vitamin D, vitamin E, vitamin K, vitamin B, vitamin C, or acombination thereof.

In one embodiment, the SARM compound is administered with abehavior-modulating agent. In some embodiments, behavior-modulatingagents include but are not limited to an anti-anxiety agent,anti-psychotic agent, anti-depressant, beta-blocker, beta-2agonist, anticholinergic bronchodilator, theophylline,aminophylline, nedocromil sodium, sodium chromoglycate, leukotrienereceptor antagonist, corticosteroid, expectorant, mucolytic agent,antihistamine, pseudoephedrine, methylphenidate, amphetamine,buspirone, benzodiazepine, dextroamphetamine, tricyclicantidepressant, serotonin reuptake inhibitor, phenothiazines,benztropine, bupropion, propranolol lithium, venlafaxine,haloperidol, buspirone, or a neuraminidase inhibitor.

In one embodiment, the behavior-modulating agent is abenzodiazepine. In one embodiment, benzodiazepines comprisealprazolam, chlordiazepoxide, diazepam, flurazepam, lorazepam,oxazepam, temazepam, or triazolam.

In one embodiment, the behavior-modulating agent is aphenothiazine. In one embodiment, phenothiazines comprisefluphenazine, perphenazine, thioridazine, or trifluoperazine.

In one embodiment, the behavior-modulating agent is a tricyclicantidepressant or a serotonin reuptake inhibitor. In oneembodiment, tricyclic antidepressants or serotonin reuptakeinhibitors comprise phenothiazine, protriptyline, fluoxetine,paroxetine, or sertraline.

In one embodiment, the SARM compound of this invention isadministered with an agent treating a connective tissue. In someembodiments, agents treating a connective tissue include but arenot limited to an anti-malaria agent, a cytotoxic agent, a steroid,corticosteroid, lupus medication, azathiprine, cyclophosphamide,anti-rheumatic agent, corticosteroid, nifedipine, aspirin,colchicine, captopril, penicillamine, azathioprine, methotrexate,prednisone, nicardipine, or a non-steroidal anti-inflammatoryagent.

In one embodiment, the compound of this invention is administeredwith an agent treating an ophthalmic disease. In some embodiments,agents treating an ophthalmic disease include but are not limitedto Betagan.RTM., Betimol.RTM., Timoptic.RTM., Betoptic.RTM.,Ocupress.RTM., Optipranolol.RTM., Xalatan.RTM., Alphagan.RTM.,Azopt.RTM., Trusopt.RTM., Cosopt.RTM., Pilocar.RTM., Pilagan.RTM.,Propine.RTM., Opticrom.RTM., Acular.RTM., Livostin.RTM.,Alomide.RTM., Emadine.RTM., Patanol.RTM., Akrex.RTM.,Poly-Pred.RTM., Pred-G.RTM., Dexacidin.RTM., erythromycin,Maxitrol.RTM., Tobradex.RTM., Blephamide.RTM., FML.RTM.,Ocufen.RTM., Voltaren.RTM., Profenal.RTM., Pred Porte.RTM.,Econpred Plus.RTM., Eflone.RTM., Flarex.RTM., Inflamase Forte.RTM.,betadine, gramicidin, prednisolone, betaxolol, Humorsol.RTM.,proparacaine, Hylartin.RTM., Inflamase Mild.RTM., Lotemax.RTM.,flurbiprofen, chloramphenicol, methazolamide, timolol Ciloxan.RTM.,terramycin, ciprofloxacin, Miostat.RTM., triamcinolone, miconazole,tobramycin, physostigmine, gentamicin, pilocarpine, bacitracin,goniosol, polymyxin, oxytetracycline, Viroptic.RTM., Vexol.RTM.,Suprofen.RTM., Celluvisc.RTM., Polytrim.RTM., Illotycin.RTM.,Ocuflox.RTM., brinzolamide, cefazolin, Tobrex.RTM., latanoprost,indocycanine, trifluridine, phenylephrine, demecarium, neomycin,tropicamide, dexamethasone, neptazane, dipivefrin, vidarabine,dorzolamide, ofloxacin, epinephrine, acyclovir, carbonic anhydraseinhibitor, antihistamine vitamin A, vitamin C, vitamin E, zinc,copper, atropine, or garamycin.

In one embodiment, the SARM compound of this invention isadministered in with a gene therapy agent. In some embodiments,gene therapy agents include but are not limited to an antisenseagent, or a replacement gene.

In one embodiment, the SARM compound of this invention isadministered in combination with an agent treating the lung. In oneembodiment, the SARM compound is administered in combination with atemozolomide, pacl*taxel, cisplatin, docetaxel or combinationthereof.

In some embodiments, any of the compositions of this invention willcomprise a compound of formula I-XX or S-(III), in any form orembodiment as described herein. In some embodiments, any of thecompositions of this invention will consist of a compound offormula I-XX or S-(III), in any form or embodiment as describedherein. In some embodiments, of the compositions of this inventionwill consist essentially of a compound of I-XX or S-(III), in anyform or embodiment as described herein. In some embodiments, theterm "comprise" refers to the inclusion of the indicated activeagent, such as the compound of formula I-XX or S-(III), as well asinclusion of other active agents, and pharmaceutically acceptablecarriers, excipients, emollients, stabilizers, etc., as are knownin the pharmaceutical industry. In some embodiments, the term"consisting essentially of" refers to a composition, whose onlyactive ingredient is the indicated active ingredient, however,other compounds may be included which are for stabilizing,preserving, etc. the formulation, but are not involved directly inthe therapeutic effect of the indicated active ingredient. In someembodiments, the term "consisting essentially of" may refer tocomponents which facilitate the release of the active ingredient.In some embodiments, the term "consisting" refers to a composition,which contains the active ingredient and a pharmaceuticallyacceptable carrier or excipient.

In one embodiment, the present invention provides combinedpreparations. In one embodiment, the term "a combined preparation"defines especially a "kit of parts" in the sense that thecombination partners as defined above can be dosed independently orby use of different fixed combinations with distinguished amountsof the combination partners i.e., simultaneously, concurrently,separately or sequentially. In some embodiments, the parts of thekit of parts can then, e.g., be administered simultaneously orchronologically staggered, that is at different time points andwith equal or different time intervals for any part of the kit ofparts. The ratio of the total amounts of the combination partners,in some embodiments, can be administered in the combinedpreparation. In one embodiment, the combined preparation can bevaried, e.g., in order to cope with the needs of a patientsubpopulation to be treated or the needs of the single patientwhich different needs can be due to a particular disease, severityof a disease, age, sex, or body weight as can be readily made by aperson skilled in the art.

It is to be understood that this invention is directed tocompositions and combined therapies as described herein, for anydisease, disorder or condition, as appropriate, as will beappreciated by one skilled in the art. Certain applications of suchcompositions and combined therapies have been describedhereinabove, for specific diseases, disorders and conditions,representing embodiments of this invention, and methods of treatingsuch diseases, disorders and conditions in a subject byadministering a SARM as herein described, alone or as part of thecombined therapy or using the compositions of this inventionrepresent additional embodiments of this invention.

Biological Activity of Selective Androgen Modulator Compounds

The SARM compounds of this invention may be useful, in someembodiments for treating, suppressing, inhibiting, reducing theseverity of, reducing the incidence of, reducing the pathogenesisof or delaying onset of, inter alia: a) muscle wasting in patientswith cancer, wherein the patients are subjected to cancer therapy;b) muscle wasting in patients with non-small cell lung cancer(NSCLC), wherein the patients are subjected to cancer therapy; c)muscle wasting in patients with non-small cell lung cancer (NSCLC),wherein the patients are subjected to taxane therapy; d)pre-cachexia or early cachexia (preventing muscle wasting in acancer patient), wherein the patients are subjected to cancertherapy; e) treating loss of physical function due to cancer orcancer therapy (radiation, chemotherapy, surgery); f) increasingphysical function of a subject, wherein the subject is subjected tocancer therapy; g) increasing physical function of a cancerpatient, wherein the patient is subjected to cancer therapy; h)increasing physical function of a cancer patient, wherein saidpatient suffers from non-small cell lung cancer, colorectal cancer,non-Hodgkin lymphoma, chronic lymphocytic leukemia or breastcancer, and is subjected to cancer therapy; i) increasing physicalfunction of a cancer patient, wherein said patient suffers fromnon-small cell lung cancer, and is subjected to taxane therapy; j)treating, suppressing, inhibiting, reducing the severity ofreducing the incidence of, reducing the pathogenesis of or delayingonset of lung cancer in a patient, wherein the patient is subjectedto cancer therapy; k) increasing survival, functional independence,and increasing quality of life of a subject suffering from cancer,and is subjected to cancer therapy; l) increasing survival,functional independence, and increasing quality of life of asubject suffering from non-small cell lung cancer, and is subjectedto taxane therapy; m) preventing or treating declines in quality oflife due to cancer or cancer therapy; and n) treating diseases,disorders or conditions related thereto; via the administration ofany SARM as herein described and optionally other therapeuticagents, including but not limited to chemotherapeutic agents, orcompositions comprising the same.

The SARMs of this invention may be useful, in some embodiments, fororal testosterone replacement therapy. In other embodiments,appropriately substituted compounds are useful for: a) malecontraception; b) treatment of a variety of hormone-relatedconditions, for example conditions associated with androgendeficiency in an aging male (ADAM), such as fatigue, depression,decreased libido, sexual dysfunction, erectile dysfunction,hypogonadism, osteoporosis, hair loss, obesity, sarcopenia,osteopenia, benign prostate hyperplasia, and alterations in moodand cognition; c) treatment of conditions associated with androgendeficiency in a female (ADIF), such as sexual dysfunction,decreased sexual libido, hypogonadism, sarcopenia, osteopenia,osteoporosis, alterations in cognition and mood, depression,anemia, hair loss, obesity, endometriosis, breast cancer, uterinecancer and ovarian cancer; d) treatment and/or prevention ofchronic muscular wasting; e) treatment of prostate cancer, imagingof prostate cancer, or decreasing the incidence of, halting orcausing a regression of prostate cancer; f) treatment of diabetestype I; g) treatment of diabetes type II; h) suppressing orinhibiting or reducing the incidence of diabetes; i) treatment ofglucose intolerance; j) treatment of hyperinsulinemia; k) treatmentof insulin resistance; l) treatment of diabetic nephropathy; m)treatment of diabetic neuropathy; n) treatment of diabeticretinopathy; o) treatment of fatty liver conditions; p) treatmentof cachexia; q) oral androgen replacement and/or other clinicaltherapeutic and/or diagnostic areas, including any embodiment ofwhat is encompassed by the term "treating" as described herein.

In some embodiments, the SARM compounds possess in vivo tissueselective androgenic and anabolic activity, which is accordinglyutilized for particular applications, as will be appreciated by oneskilled in the art.

In one embodiment, this invention provides: a) a method of treatinga subject having a muscle wasting disorder; b) a method of treatinga subject suffering from malnutrition; c) a method of treating abone-related disorder in a subject; d) a method of increasing abone mass in a subject; e) a method of improving the lipid profilein a subject; f) a method of treating atherosclerosis and itsassociated diseases; g) a method of improving dexterity andmovement in a subject; h) a method of treating a subject sufferingfrom dwarfism; i) a method of treating a subject havingdysmenorrhea; j) a method of treating a subject having dysparuia;and k) a method of treating a subject having dysspermtogenicsterility; comprising the step of administering to said subject aselective androgen receptor modulator (SARM) compound of formulaI-XX or S-(III) and/or an analog, derivative, isomer, metabolite,pharmaceutically acceptable salt, pharmaceutical product, hydrate,N-oxide, prodrug, polymorph, impurity or crystal of said SARMcompound, or any combination thereof.

In some embodiments, the SARMs as described herein and/orcompositions comprising the same may be used for applications andtreating diseases in which the improvement of cognition, reductionor treatment of depression, or other neuroprotective effects aredesired.

In one embodiment, the methods of this invention are useful asubject, which is a human. In another embodiment, the subject is amammal. In another embodiment the subject is an animal. In anotherembodiment the subject is an invertebrate. In another embodimentthe subject is a vertebrate.

In one embodiment, the subject is male. In another embodiment, thesubject is female. In some embodiments, while the methods asdescribed herein may be useful for treating either males orfemales, females may respond more advantageously to administrationof certain compounds, for certain methods, as described andexemplified herein.

In some embodiments, while the methods as described herein may beuseful for treating either males or females, males may respond moreadvantageously to administration of certain compounds, for certainmethods, as described herein.

In some embodiments, the SARMs as described herein and/orcompositions may be used for applications in or treating hair loss,alopecia, androgenic alopecia, alopecia areata, alopecia secondaryto chemotherapy, alopecia secondary to radiation therapy, alopeciainduced by scarring or alopecia induced by stress. In oneembodiment, "hair loss", or "alopecia", refers to baldness as inthe very common type of male-pattern baldness. Baldness typicallybegins with patch hair loss on the scalp and sometimes progressesto complete baldness and even loss of body hair. Hair loss affectsboth males and females.

In some embodiments, the SARMs as described herein and/orcompositions comprising the same may be used for applications in,or treating diseases or conditions associated with a subject havinganemia. In one embodiment, "anemia" refers to the condition ofhaving less than the normal number of red blood cells or less thanthe normal quantity of hemoglobin in the blood, reduced hematocritor reduced mean corpuscular volume, or reduced corpuscular size.The oxygen-carrying to capacity of the blood is decreased inanemia. In some embodiments, treating anemia may also refer hereinto treating underlying factors resulting in anemia, such as forexample a) hemorrhage (bleeding); b) hemolysis (excessivedestruction of red blood cells); c) underproduction of red bloodcells; and d) not enough normal hemoglobin. In some embodiments,treating anemia in this invention refers to treating any formthereof, including aplastic anemia, benzene poisoning. Fanconianemia, hemolytic disease of the newborn, hereditary spherocytosis,iron deficiency anemia, osteoporosis, pernicious anemia, sicklecell disease, aplastic anemia, hemolytic anemia, sickle cellanemia, renal anemia, thalassemia, myelodysplastic syndrome, and avariety of bone marrow diseases.

In some embodiments, the SARMs as described herein and/orcompositions comprising the same may be used for applications inand/or treating diseases and/or conditions associated with problemswith a subject's libido, or erectile dysfunction in a subject. Inone embodiment, "libido", may refer to sexual desire.

In one embodiment, the term "erectile" refers to the ability to beerect or upright. An erectile tissue is a tissue, which is capableof being greatly dilated and made rigid by the distension of thenumerous blood vessels, which it contains.

In another embodiment of the present invention, a method isprovided for hormonal therapy in a patient (i.e., one sufferingfrom an androgen-dependent condition) which includes contacting anandrogen receptor of a patient with a SARM compound and/or a nonsteroidal agonist of the present invention and/or its analog,derivative, isomer, metabolite, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, hydrate,N-oxide or any combination thereof, in an amount effective to bindthe SARM compound to the androgen receptor and effect a change inan androgen-dependent condition.

In one embodiment of this invention, a method is provided forhormone replacement therapy in a patient (i.e., one suffering froman androgen-dependent condition) which includes administering aSARM compound as herein described and/or its analog, derivative,isomer, metabolite, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, hydrate,N-oxide or any combination thereof, to a subject, in an amountsufficient to effect a change in a hormone-dependent condition inthe subject.

Androgen-dependent conditions which may be treated with thecompounds and/or compositions as herein described, comprising themethods of the present invention include those conditions which areassociated with aging, hypogonadism, sarcopenia, diminishederythropoiesis, osteoporosis, and any other conditions dependentupon low androgen (e.g., testosterone) or estrogen levels.

Androgen-dependent conditions which may be treated with thecompounds and/or compositions as herein described, and comprising amethod of the invention, may comprise conditions characterized byelevated androgen or estrogen levels, including hirsutism,infertility, polycystic ovarian syndrome, endometrial carcinoma,breast cancer, male pattern baldness, prostate cancer, testicularcancer, and others, as will be known to one skilled in the art. Forsuch conditions, the subject may be administered a SARM as hereindescribed, alone or in combination with another therapeutic agent,as will be appreciated by one skilled in the art.

In one embodiment this invention provides methods for the treatmentof a cancer in a subject, reduction of incidence or severity orpathogenesis of a cancer in a subject, delaying progression,prolonging remission or delaying onset of cancer in a subject,comprising the step of administering to the subject a SARM compoundas herein described and/or its analog, derivative, isomer,metabolite, pharmaceutically acceptable salt, pharmaceuticalproduct, polymorph, crystal, impurity, hydrate, N-oxide or anycombination thereof. In some embodiments, such cancers arehormone-dependent or associated with reproductive tissue in malesor females, such as cancer of the prostate, ovary, breast, uterus,testicl*, or others.

In some embodiments, this invention provides methods for thetreatment of a precancerous precursor or lesion in a subject,reduction of incidence of precancerous precursors or lesions in asubject, comprising the step of administering to the subject a SARMcompound as herein described and/or its analog, derivative, isomer,metabolite, pharmaceutically acceptable salt, pharmaceuticalproduct, polymorph, crystal, impurity, hydrate, N-oxide or anycombination thereof. In some embodiments, such precancerousprecursors are found in hormone-responsive tissue or are associatedwith reproductive tissue in males or females, such as in theprostate, ovary, breast, uterus, testicl*, or others. In someembodiments, such precancerous precursors comprise any localintraepithelial neoplasia, for example, of the prostate, thecervix, etc. In some embodiments, such methods are useful intreating neoplasia or pre-neoplasia, dysplasia or hyperplasia in atissue, such as in reproductive tissue in males or females.

In one embodiment, this invention provides compounds, compositionsand/or methods of use thereof in treating benign prostatehyperplasia (BPH). "BPH (benign prostate hyperplasia)" is anonmalignant enlargement of the prostate gland, and is the mostcommon non-malignant proliferative abnormality found in anyinternal organ and the major cause of morbidity in the adult male.BPH occurs in over 75% of men over 50 years of age, reaching 88%prevalence by the ninth decade. BPH frequently results in a gradualsqueezing of the portion of the urethra which traverses theprostate (prostatic urethra). This causes patients to experience afrequent urge to urinate because of incomplete emptying of thebladder and urgency of urination. The obstruction of urinary flowcan also lead to a general lack of control over urination,including difficulty initiating urination when desired, as well asdifficulty in preventing urinary flow because of the inability toempty urine from the bladder, a condition known as overflow urinaryincontinence, which can lead to urinary obstruction and to urinaryfailure.

In another embodiment of the present invention, the method fortreating benign prostate hyperplasia (BPH) in a subject, comprisesthe step of administering to the subject a SARM compound as hereindescribed and/or its analog, derivative, isomer, metabolite,pharmaceutically acceptable salt, pharmaceutical product,polymorph, crystal, impurity, hydrate, N-oxide or any combinationthereof, in an amount effective to treat BPH in the subject.

In another embodiment of the present invention, this inventionprovides a method for treating, including all embodimentsencompassed by such term, prostatitis in a subject, comprises thestep of administering to the subject a SARM compound as hereindescribed and/or its analog, derivative, isomer, metabolite,pharmaceutically acceptable salt, pharmaceutical product,polymorph, crystal, impurity, hydrate, N-oxide or any combinationthereof, in an amount effective to treat prostatitis in thesubject.

In some embodiments, this invention provides for the use of a SARMcompound as herein described, or its prodrug, analog, isomer,metabolite, derivative, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, N-oxide,hydrate or any combination thereof, for treating, reducing theseverity of, reducing the incidence of, or reducing thepathogenesis of cachexia and/or cachexia associated with cancer ina subject. In another embodiment, the cancer comprisesadrenocortical carcinoma, anal cancer, bladder cancer, brain tumor,brain stem glioma, brain tumor, cerebellar astrocytoma, cerebralastrocytoma, colorectal cancer, chronic lymphocytic leukemia,ependymoma, medulloblastoma, supratentorial primitiveneuroectodermal, pineal tumors, hypothalamic glioma, breast cancer,carcinoid tumor, carcinoma, cervical cancer, colon cancer,endometrial cancer, esophageal cancer, extrahepatic bile ductcancer, Ewings family of tumors (Pnet), extracranial germ celltumor, eye cancer, intraocular melanoma, gallbladder cancer,gastric cancer, germ cell tumor, extragonadal, gestationaltrophoblastic tumor, head and neck cancer, hypopharyngeal cancer,islet cell carcinoma laryngeal cancer, leukemia, acutelymphoblastic leukemia, oral cavity cancer, liver cancer, lung can,small cell kung cancer, non-small cell kung cancer (NSCLC),lymphoma, AIDS-related lymphoma, central nervous system (primary),lymphoma, cutaneous T-cell, lymphoma, Hodgkin's disease,on-Hodgkin's disease, malignant mesothelioma, melanoma, Markel cellcarcinoma, metastatic squamous carcinoma, multiple myeloma, plasmacell neoplasms, mycosis fungoides, myelodysplastic syndrome,myeloproliferative disorders, nasopharyngeal cancer, neuroblastoma,oropharyngeal cancer, osteosarcoma, ovarian epithelial cancer,ovarian germ cell tumor, ovarian low malignant potential tumor,pancreatic cancer, exocrine, pancreatic cancer, islet cellcarcinoma, paranasal sinus and nasal cavity cancer, parathyroidcancer, penile cancer, pheochromocytoma cancer, pituitary cancer,plasma cell neoplasm, prostate cancer, rhabdomyosarcoma, rectalcancer, renal cell cancer, salivary gland cancer, Sezary syndrome,skin cancer, cutaneous T-cell lymphoma, skin cancer, Kaposi'ssarcoma, skin cancer, melanoma, small intestine cancer, soft tissuesarcoma, soft tissue sarcoma, testicular cancer, thymoma,malignant, thyroid cancer, urethral cancer, uterine cancer,sarcoma, unusual cancer of childhood, vagin*l cancer, vulvarcancer. Wilms' tumor, or any combination thereof. In anotherembodiment, the SARM is compound of formula II as describedhereinabove. In another embodiment, the SARM is compound of formulaS-(III) as described hereinabove. In another embodiment, the cancerpatient is subjected to a cancer therapy. In another embodiment,the cancer patient is subjected to radiation therapy. In anotherembodiment, the compound is administered in combination withradiation therapy. In another embodiment, the compound isadministered in combination with a chemotherapeutic agent. Inanother embodiment, the chemotherapeutic agent comprisesbendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab, chlorambucil, cisplatin,cyclophosphamide, cytarabine, dasatinib, docetaxel, doxorubicin,erlotinib, etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib methotrexate,methylprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof.

In another embodiment, this invention provides the use of a SARMcompound as herein described including comprising an analog,derivative, isomer, metabolite, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, hydrate,N-oxide or any combination thereof, of a compound of formulaS-(III) for treating, reducing the severity of, reducing theincidence of, or delaying the onset of lung cancer, which in oneembodiment is non-small cell lung cancer. In another embodiment,the lung cancer patient is subjected to a cancer therapy. Inanother embodiment, the lung cancer patient is subjected toradiation therapy. In another embodiment, the compound isadministered in combination with radiation therapy. In anotherembodiment, the compound is administered in combination with achemotherapeutic agent. In another embodiment, the chemotherapeuticagent comprises: bendamustine, bevacizumab, bleomycin, calciumfolinate, capecitabine, carboplatin, cetuximab, chlorambucil,cisplatin, cyclophosphamide, cytarabine, dasatinib docetaxel,doxorubicin, erlotinib, etoposide, fludarabine, fluorouracil,gemcitabine hydrochloride, irinotecan hydrochloride, lapatinib,methotrexate, methylprednisolone acetate, mitoxantrone,mitoxantrone hydrochloride, oxaliplatin, pacl*taxel, pamidronatedisodium, panitumumab pemetrexed, prednisone, rituximab,trastuzumab, vincristine, vinorelbine or any combinationthereof.

In another embodiment, this invention provides the use of a SARMcompound as herein described including comprising an analog,derivative, isomer, metabolite, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, hydrate,N-oxide or any combination thereof, of a compound of formulaS-(III) for treating reducing the severity of, reducing theincidence of, or delaying the onset of cachexia or other conditionsarising as a result of lung cancer in the subject, which in oneembodiment is non-small cell lung cancer.

In another embodiment, the lung cancer patient is subjected to acancer therapy. In another embodiment, the lung cancer patient issubjected to radiation therapy. In another embodiment the compoundis administered in combination with radiation therapy. In anotherembodiment, the compound is administered in combination with achemotherapeutic agent. In another embodiment, the chemotherapeuticagent comprises: bendamustine, bevacizumab, bleomycin, calciumfolinate, capecitabine, carboplatin, cetuximab, chorambucil,cisplatin, cyclophosphamide, cytarabine, dasatinib, docetaxel,doxorubicin, erlotinib, etoposide, fludarabine, fluorouracil,gemcitabine hydrochloride, irinotecan hydrochloride, lapatinib,methotrexate, methylprednisone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of muscle wasting in a human subjectwith cancer, comprising administering a compound of this invention.In another embodiment, the compound is compound of formula II asdescribed hereinabove. In another embodiment, the compound iscompound of formula S-(III) as described hereinabove. In anotherembodiment, said subject suffers from non-small cell lung cancer.In another embodiment the subject suffers from colon cancer. Inanother embodiment the subject suffers from breast cancer. Inanother embodiment the subject suffers from non-Hodgkin's lymphoma.In another embodiment the subject suffers chronic lymphocyticleukemia. In another embodiment the subject suffers from lungcancer. In another embodiment, the cancer patient is subjected to acancer therapy. In another embodiment, the cancer patient issubjected to radiation therapy. In another embodiment, the compoundis administered in combination with radiation therapy. In anotherembodiment, the compound is administered in combination with achemotherapeutic agent. In another embodiment, the chemotherapeuticagent comprises: bendamustin, bevacizumab, bleomycin, calciumfolinate, capecitabine, carboplatin, cetuximab, chlorambucil,cisplatin, cyclophosphamide, cytarabine, dasatinib, docetaxel,doxorubicin, erlotinib, etoposide, fludarabine, fluorouracil,gemcitabine hydrochloride, irinotecan hydrochloride, lapatinib,methotrexate, methylprednisolone acetate, mitoxantrone,mitoxantrone, hydrochloride, oxaliplatin, pacl*taxel, pamidronatedisodium, panitumumab, pemetrexed, prednisone, rituximab,trastuzumab, vincristine, vinorelbine or any combinationthereof.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of muscle wasting in a human subjectwith non-small cell lung cancer, comprising the step ofadministering to said subject a compound of this invention. Inanother embodiment, the compound is compound of formula II asdescribed hereinabove. In another embodiment, the compound iscompound of formula S-(III) as described hereinabove. In anotherembodiment, the non-small cell lung cancer patient is subjected toa cancer therapy. In another embodiment, the non-small cell lungcancer patient is subjected to radiation therapy. In anotherembodiment, the non-small cell lung cancer patient is subjected totaxane therapy. In another embodiment, the non-small cell lungcancer patient is subjected to taxane and platinum therapy. Inanother embodiment, the non-small cell lung cancer patient issubjected to platinum and non-taxane chemotherapy. In anotherembodiment, the compound is administered in combination withradiation therapy. In another embodiment, the compound isadministered in combination with a chemotherapeutic agent. Inanother embodiment, the chemotherapeutic agent comprises:bendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab, chlorambucil, cisplatin,cyclophosphamide, cytarabine, dasatinib, docetaxel, doxorubicin,erlotinib, etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib, methotrexate,methylprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof.

In another embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of muscle wasting in ahuman subject with non-small cell lung cancer, said methodcomprises administering a selective androgen receptor modulator(SARM) compound of formula II:

##STR00030## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isan alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl, halogen, N(R).sub.2,CN, NHCOCH.sub.3, NHCOCF.sub.3r NHCOR, NHCONHR, NHCOOR, OCONHR,CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3.NHSO.sub.2R, OR, COR, OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido, alkylamines, ether, alkyl, N-sulfonyl,O-sulfonyl, alkylsulfonyl, carbonyl, or a ketone; wherein saidsubject is subjected to cancer therapy.

In another embodiment, Q is CN.

In another embodiment, said method comprises administering aselective androgen receptor modulator (SARM) compound of formula orS-(III):

##STR00031##

In another embodiment, this invention provides a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of muscle wasting in ahuman subject with non-small cell lung cancer, wherein said subjectis subjected to a cancer therapy. In another embodiment, thesubject is subjected to taxane therapy. In another embodiment,subject is subjected to taxane and platinum therapy. In anotherembodiment, the subject is subjected to platinum andnon-taxanechemotherapy. In another embodiment, the cancer therapyis radiation therapy. In another embodiment, the cancer therapy ischemotherapy. In another embodiment, the compound is compound offormula II as described hereinabove. In another embodiment, thecompound is compound of formula S-(III) as described hereinabove.In another embodiment, the compound is administered in combinationwith radiation therapy. In another embodiment, the compound isadministered in combination with a chemotherapeutic agent. Inanother embodiment, the chemotherapeutic agent comprisesbendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab, chorambucil, cisplatin,cyclophosphamide, cytarabine, dasatinib docetaxel, doxorubicin,erlotinib etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib, methotrexate,methyprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof. In anotherembodiment, the chemotherapeutic agent comprises platinum andtaxane. In another embodiment, the chemotherapeutic agent comprisesplatinum and non-taxane chemotherapeutic agent. In anotherembodiment, said method further increases the physical function ofsaid subject. In another embodiment, said method further increasesthe quality of life of said subject. In another embodiment, saidmethod further increases the lean body mass of said subject.

In another embodiment, this invention provides a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of muscle wasting in ahuman subject with cancer, wherein said subject is subjected to acancer therapy. In another embodiment, the cancer therapy isradiation therapy. In another embodiment, the cancer therapy ischemotherapy. In another embodiment, the compound is administeredin combination with radiation therapy. In another embodiment, thecompound is administered in combination with a chemotherapeuticagent. In another embodiment, the chemotherapeutic agent comprises:bendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab, chorambucil cisplatin,cyclophosphamide, cytarabine, dasatinib, docetaxel, doxorubicin,erlotinib, etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib, methotrexate,methylprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof. In anotherembodiment, the chemotherapeutic agent comprises platinum andtaxane. In another embodiment, the chemotherapeutic agent comprisesplatinum and non-taxane chemotherapeutic agent. In anotherembodiment, said method further increases the physical function ofsaid subject. In another embodiment, said method further increasesthe quality of life of said subject. In another embodiment, saidmethod further increases lean body mass of a subject. In anotherembodiment, the cancer is non-small cell lung cancer. In anotherembodiment the cancer is colon cancer. In another embodiment thecancer is breast cancer. In another embodiment the cancer isnon-Hodgkin's lymphoma. In another embodiment the cancer is chroniclymphocytic leukemia. In another embodiment the cancer is lungcancer.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cachexia, pre-cachexia or earlycachexia in a subject with cancer, comprising the step ofadministering a compound of this invention. In another embodiment,said method comprises administering a selective androgen receptormodulator (SARM) compound of formula II:

##STR00032## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isan alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl, halogen, N(R), CN,NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR,NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3, NHSO.sub.2R,OR, COR, OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines, ether, alkyl, N-sulfonyl,O-sulfonyl, alkylsulfonyl, carbonyl, or a ketone; wherein saidsubject is subjected to cancer therapy.

In another embodiment, Q is CN.

In another embodiment, said method comprises administering aselective androgen receptor modulator (SARM) compound of formulaS-(III):

##STR00033##

In another embodiment, this invention provides a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of cachexia, pre-cachexiaor early cachexia in a subject with cancer, wherein said subject issubjected to a cancer therapy. In another embodiment, the cancertherapy is radiation therapy. In another embodiment, the cancertherapy is chemotherapy. In another embodiment, the compound isadministered in combination with radiation therapy. In anotherembodiment, the compound is administered in combination with achemotherapeutic agent. In another embodiment, the chemotherapeuticagent comprises: bendamustine, bevacizumab, bleomycin, calciumfolinate, capecitabine, carboplatin, cetuximab, chlorambucil,cisplatin, cyclophosphamide, cytarabine, dasatinib, docetaxel,doxorubicin, erlotinib, etoposide, fludarabine, fluorouracil,gemcitabine hydrochloride, irinotecan hydrochloride, lapatinib,methotrexate, methylprednisolone acetate, mitoxantrone,mitoxantrone hydrochloride, oxaliplatin, pacl*taxel, pamidronatedisodium, panitumumab, pemetrexed, prednisone, rituximab,trastuzumab, vincristine, vinorelbine or any combination thereof.In another embodiment, the chemotherapeutic agent comprisesplatinum and taxane. In another embodiment, the chemotherapeuticagent comprises platinum and non-taxane chemotherapeutic agent. Inanother embodiment, said method further increases the physicalfunction of said subject. In another embodiment, said methodfurther increases the quality of life of said subject. In anotherembodiment, said method further increases lean body mass of asubject. In another embodiment, said method further increases thesurvival of said subject. In another embodiment, said subjectsuffers from non-small cell lung cancer. In another embodiment thesubject suffers from colon cancer. In another embodiment thesubject suffers from breast cancer. In another embodiment thesubject suffers from non-Hodgkin's lymphoma. In another embodimentthe subject suffers chronic lymphocytic leukemia. In anotherembodiment the subject suffers from lung cancer.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of pre-cachexia or early cachexia in asubject suffering from cancer, comprising the step of administeringa compound of this invention. In another embodiment, said methodcomprising administering a selective androgen receptor modulator(SARM) compound of formula II:

##STR00034## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isan alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl, halogen, N(R), CN,NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR,NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3, NHSO.sub.2R,OR, COR, OCOR OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines ether, alkyl, N-sulfonyl,O-sulfonyl, alkysulfonyl, carbonyl, or a ketone; wherein saidsubject is subjected to cancer therapy.

In another embodiment Q is CN.

In another embodiment, said method comprising administering aselective androgen receptor modulator (SARM) compound of formulaS-(III):

##STR00035##

In another embodiment, this invention provides a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of pre-cachexia or earlycachexia in a subject suffering from cancer, wherein said subjectis subjected to a cancer therapy. In another embodiment, the cancertherapy is radiation therapy. In another embodiment, the cancertherapy is chemotherapy. In another embodiment, the compound isadministered in combination with radiation therapy. In anotherembodiment, the compound is administered in combination with achemotherapeutic agent. In another embodiment, the chemotherapeuticagent comprises: bendamustine, bevacizumab, bleomycin, calciumfolinate, capecitabine, carboplatin, cetuximab, chlorambucil,cisplatin, cyclophosphamide, cytarabine, dasatinib, docetaxel,doxorubicin, erlotinib, etoposide, fludarabine, fluorouracil,gemcitabine hydrochloride, irinotecan hydrochloride, lapatinib,methotrexate, methylprednisolone acetate, mitoxantrone,mitoxantrone hydrochloride, oxaliplatin, pacl*taxel, pamidronatedisodium, panitumumab, pemetrexed, prednisone, rituximab,trastuzumab, vincristine, vinorelbine or any combination thereof.In another embodiment, the chemotherapeutic agent comprisesplatinum and taxane. In another embodiment, the chemotherapeuticagent comprises platinum and non-taxane chemotherapeutic agent. Inanother embodiment, said method further increases the physicalfunction of said subject. In another embodiment, said methodfurther increases the quality of life of said subject. In anotherembodiment, said method increases the survival of said subject. Inanother embodiment, said method further increases lean body mass ofa subject

In another embodiment, the cancer is non-small cell lungcancer.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of lung cancer in a subject,comprising the step of administering a compound of this invention.In another embodiment, said method comprises administering aselective androgen receptor modulator (SARM) compound of formulaII:

##STR00036## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isan alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl halogen, N(R).sub.2, CN,NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR, CONHR,NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3, NHSO.sub.2R,OR, COR, OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines, ether, alkyl, N-sulfonyl,O-sulfonyl, alkylsulfonyl, carbonyl, or a ketone; wherein saidsubject is subjected to cancer therapy.

In another embodiment, Q is CN.

In another embodiment, said method comprises administering aselective androgen receptor modulator (SARM) compound of formulaS-(III):

##STR00037##

In another embodiment, this invention provides a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of lung cancer in asubject, wherein said subject is subjected to a cancer therapy. Inanother embodiment, the cancer therapy is radiation therapy. Inanother embodiment, the cancer therapy is chemotherapy. In anotherembodiment, the compound is administered in combination withradiation therapy. In another embodiment, the compound isadministered in combination with a chemotherapeutic agent. Inanother embodiment, the chemotherapeutic agent comprises:bendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab, chlorambucil, cisplatin,cyclophosphamide, cytarabine, dasatinib, docetaxel, doxorubicin,erlotinib, etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib, methotrexate,methylprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof. In anotherembodiment, the chemotherapeutic agent comprises platinum andtaxane. In another embodiment, the chemotherapeutic agent comprisesplatinum and non-taxane chemotherapeutic agent. In anotherembodiment, said method further increases the physical function ofsaid subject. In another embodiment, said method further increasesthe quality of life of said subject. In another embodiment, saidmethod further increases the survival of said subject. In anotherembodiment, said method further increases lean body mass of asubject

In another embodiment, said subject suffers from non-small celllung cancer. In another embodiment the subject suffers from coloncancer. In another embodiment the subject suffers from breastcancer. In another embodiment the subject suffers fromnon-Hodgkin's lymphoma. In another embodiment the subject sufferschronic lymphocytic leukemia. In another embodiment the subjectsuffers from lung cancer.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of non-small cell lung cancer in asubject, comprising the step of administering a compound of thisinvention. In another embodiment, said method comprisesadministering a selective androgen receptor modulator (SARM)compound of formula II:

##STR00038## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isan alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl, halogen, N(R).sub.2,CN, NHCOCH.sub.3, NHCOCF.sub.3, NHCOR NHCONHR, NHCOOR, OCONHR,CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3,NHSO.sub.2R, OR, COR, OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines, ether, alkyl, N-sulfonyl,O-sulfonyl, alkylsufonyl, carbonyl or a ketone; wherein saidsubject is subjected to cancer therapy.

In another embodiment, Q is CN.

In another embodiment, said method comprises administering aselective androgen receptor modulator (SARM) compound of formulaS-(III):

##STR00039##

In another embodiment, this invention provides a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of non-small cell lungcancer in a subject, wherein said subject is subjected to a cancertherapy. In another embodiment, the cancer therapy is radiationtherapy. In another embodiment, the cancer therapy is chemotherapy.In another embodiment, the compound is administered in combinationwith radiation therapy. In another embodiment, the compound isadministered in combination with a chemotherapeutic agent. Inanother embodiment, the chemotherapeutic agent comprises:bendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab, chlorambucil, cisplatin,cyclophosphamide, cytarabine, dasatinib, docetaxel, doxorubicin,erlotinib, etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib, methotrexate,methylprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab trastuzumab,vincristine, vinorelbine or any combination thereof. In anotherembodiment, the chemotherapeutic agent comprises platinum andtaxane. In another embodiment, the chemotherapeutic agent comprisesplatinum and non-taxane chemotherapeutic agent. In anotherembodiment, said method further increases the physical function ofsaid subject. In another embodiment, said method further increasesthe quality of life of said subject. In another embodiment, saidmethod further increases the survival of said subject. In anotherembodiment, said method further increases lean body mass of asubject. In another embodiment, said subject suffers from non-smallcell lung cancer. In another embodiment the subject suffers fromcolon cancer. In another embodiment the subject suffers from breastcancer. In another embodiment the subject suffers fromnon-Hodgkin's lymphoma. In another embodiment the subject sufferschronic lymphocytic leukemia. In another embodiment the subjectsuffers from lung cancer.

In some embodiments, this invention provides the use of a SARMcompound as herein described including comprising an analog,derivative, isomer, metabolite, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, hydrate,N-oxide or any combination thereof, of a compound of formulaS-(III) for treating, reducing the severity, reducing theincidence, or reducing the pathogenesis of cancer. In anotherembodiment, the cancer comprises androgen AR dependent tumors(malignant or benign) such as prostate cancer, or breast cancer(male or female, operable or inoperable). In another embodiment theSARM compounds adjunct to ADT for treating prostate cancer, bladdercancers, brain cancers, bone tumors, colon cancer, endometrialcancer, liver cancer, lung cancer, non-small cell lung cancer,lymphatic cancer, kidney cancer, osteosarcoma cancer, ovariancancer, pancreas cancer, penis cancer, skin cancer, thyroid cancer,and/or hormone-dependent cancers.

In one embodiment, this invention provides for the use of a SARMcompound as herein described, or its prodrug, analog, isomer,metabolite, derivative, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, N-oxide,hydrate or any combination thereof, for: a) treating a bone relateddisorder; b) preventing a bone related disorder; c) suppressing abone related disorder; d) inhibiting a bone related disorder; e)increasing a strength of a bone of a subject; f) increasing a bonemass in a subject; or g) use for osteoclastogenesis inhibition.

In one embodiment, this invention provides for the use of a SARMcompound as herein described including comprising an analog,derivative, isomer, metabolite, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, hydrate,N-oxide or any combination thereof, of a compound of formula I fora) accelerating bone repair; b) treating bone disorders; c)treating bone density loss; d) treating low bone mineral density(BMD); e) treating reduced bone mass; f) treating metabolic bonedisease; g) promoting bone growth or regrowth; h) promoting bonerestoration; i) promoting bone fracture repair; j) promoting boneremodeling k) treating bone damage following reconstructive surgeryincluding of the face, hip, or joints; l) enhancing of bonestrength and function; m) increasing cortical bone mass; or n)increasing trabecular connectivity.

In one embodiment, the bone related disorder is a genetic disorder,or in another embodiment, is induced as a result of a treatmentregimen for a given disease. For example, and in one embodiment,the SARMs as herein described are useful in treating a bone-relateddisorder that arises as a result of cancer metastasis to bone, orin another embodiment, as a result of androgen-deprivation therapy,for example, given in response to prostate carcinogenesis in thesubject.

In one embodiment, the bone-related disorder is osteoporosis. Inanother embodiment the bone-related disorder is osteopenia. Inanother embodiment, the bone-related disorder is to increased boneresorption. In another embodiment, the bone-related disorder isbone fracture. In another embodiment, the bone-related disorder isbone frailty.

In another embodiment, the bone-related disorder is a loss of bonemineral density (BMD). In another embodiment, the bone-relateddisorder is any combination of osteoporosis, osteopenia, increasedbone resorption, bone fracture, bone frailty and loss of BMD. Eachdisorder represents a separate embodiment of the presentinvention.

"Osteoporosis" refers, in one embodiment, to a thinning of thebones with reduction in bone mass due to depletion of calcium andbone protein. In another embodiment, osteoporosis is a systemicskeletal disease, characterized by low bone mass and deteriorationof bone tissue, with a consequent increase in bone fragility andsusceptibility to fracture. In osteoporotic patients, bone strengthis abnormal, in one embodiment, with a resulting increase in therisk of fracture. In another embodiment, osteoporosis depletes boththe calcium and the protein collagen normally found in the bone, inone embodiment, resulting in either abnormal bone quality ordecreased bone density. In another embodiment, bones that areaffected by osteoporosis can fracture with only a minor fall orinjury that normally would not cause a bone fracture. The fracturecan be, in one embodiment, either in the form of cracking (as in ahip fracture) or collapsing (as in a compression fracture of thespine). The spine, hips, and wrists are common areas ofosteoporosis-induced bone fractures, although fractures can alsooccur in other skeletal areas. Unchecked osteoporosis can lead, inanother embodiment, to changes in posture, physical abnormality,and decreased mobility.

In one embodiment, the osteoporosis results from androgendeprivation. In another embodiment, the osteoporosis followsandrogen deprivation. In another embodiment, the osteoporosis isprimary osteoporosis. In another embodiment, the osteoporosis issecondary osteoporosis. In another embodiment, the osteoporosis ispostmenopausal osteoporosis. In another embodiment, theosteoporosis is juvenile osteoporosis. In another embodiment, theosteoporosis is idiopathic osteoporosis. In another embodiment, theosteoporosis is senile osteoporosis.

In another embodiment, the primary osteoporosis is type I primaryosteoporosis. In another embodiment, the primary osteoporosis istype II primary osteoporosis. Each type of osteoporosis representsa separate embodiment of the present invention.

According to this aspect of the invention and in one embodiment,the bone-related disorder is treated with a SARM compound as hereindescribed, or a combination thereof. In another embodiment, otherbone-stimulating compounds can be provided to the subject, priorto, concurrent with or following administration of a SARM or SARMsas herein described. In one embodiment, such a bone stimulatingcompound may comprise natural or synthetic materials.

In one embodiment, the bone stimulating compound may comprise abone morphogenetic protein (BMP), a growth factor, such asepidermal growth factor (EOF), a fibroblast growth factor (FGF), atransforming growth factor (TGF), an insulin growth factor (IGF), aplatelet-derived growth factor (PDGF), hedgehog proteins such assonic, indian and desert hedgehog, a hormone such as folliclestimulating hormone, parathyroid hormone, parathyroid hormonerelated peptide, activins, inhibins, follistatin, fizzled, frzb orfrazzled proteins, BMP binding proteins such as chordin and fetuin,a cytokine such as IL-3, IL-7, GM-CSF, a chemokine, such aseotaxin, a collagen, osteocalcin, osteonectin and others, as willbe appreciated by one skilled in the at.

In another embodiment, the compositions for use in treating a bonedisorder of this invention may comprise a SARM or SARMs as hereindescribed, an additional bone stimulating compound, or compounds,and osteogenic cells. In one embodiment, an osteogenic cell may bea stem cell or progenitor cell, which may be induced todifferentiate into an osteoblast. In another embodiment, the cellmay be an osteoblast. In another embodiment, nucleic acids whichencode bone-stimulating compounds may be administered to thesubject, which is to be considered as part of this invention.

In one embodiment, the methods of the present invention compriseadministering the SARM compound for treating osteoporosis. Inanother embodiment, the methods of this invention compriseadministering a SARM compound in combination with SERMs fortreating osteoporosis. In another embodiment, the SERMs aretamoxifen, 4-hydroxytamoxifen, idoxifene, toremifene, ospemifene,droloxifene, raloxifene, arzoxifene, bazedoxifene, PPT(1,3,5-tris(4-hydroxyphenyl)-4-propy-1H-pyrazol), DPN,lasofoxifene, pipendoxifene, EM-800, EM-652, nafoxidine,zindoxifene, tesmilifene, miproxifene phosphate, RU 58,688, EM 139,ICI 164.384, IC 182,780, clomiphene, MER-25, diethylstilbestrol,coumestrol, genistein, GW5638, LY353581, zuclomiphene,enclomiphene, delmadinone acetate, DPPE(N,N-diethyl-2-(4-(phenylmethyl)-phenoxy)ethanamine), TSE-424,WAY-070, WAY-292, WAY-818, cyclocommunol, prinaberel, ERB-041,WAY-397, WAY-244, ERB-196, WAY-169122, MF-101, ERb-002, ERB-037,ERB-017, BE-1060, BE-380, BE-381, WAY-358, [.sup.18F]FEDNP,LSN-500307, AA-102, CT-101, CT-102, or VG-101.

In one embodiment, this invention provides for the treatment,prevention, suppression or inhibition of, or the reduction of therisk of developing a skeletal-related event (SRE), such as bonefractures, surgery of the bone, radiation of the bone, spinal cordcompression, new bone metastasis, bone loss, or a combinationthereof in a subject with cancer, comprising administering to the aselective androgen receptor modulator (SARM) as herein describedand/or its analog, derivative, isomer, metabolite, pharmaceuticallyacceptable salt, pharmaceutical product, hydrate, N-oxide, or anycombination thereof. The invention relates, inter alia to treatmentof an SRE with the compound of formula S-(III) in a subject withprostate cancer undergoing or having undergone androgen deprivationtherapy (ADT).

In one embodiment, the skeletal-related events treated using themethods provided herein and/or utilizing the compositions providedherein, are fractures, which in one embodiment, are pathologicalfractures, non-traumatic fractures, vertebral fracture,non-vertebral fractures, morphometric fractures, or a combinationthereof. In some embodiments, fractures may be simple, compound,transverse, greenstick, or comminuted fractures. In one embodiment,fractures may be to any bone in the body, which in one embodiment,is a fracture in any one or more bones of the arm, wrist, hand,finger, leg, ankle, foot, toe, hip, collar bone, or a combinationthereof.

In another embodiment, the methods and/or compositions providedherein, are effective in treatment, prevention, suppression,inhibition or reduction of the risk of skeletal-related events suchas pathologic fractures, spinal cord compression, hypercalcemia,bone-related pain, or their combination.

In another embodiment, the skeletal-related events sought to betreated using the methods provided herein and/or utilizing thecompositions provided herein, comprise the necessity for bonesurgery and/or bone radiation, which in some embodiments, is forthe treatment of pain resulting in one embodiment from bone damage,or nerve compression. In another embodiment, the skeletal-relatedevents sought to be treated using the methods provided hereinand/or utilizing the compositions provided herein, comprise spinalcord compression, or the necessity for changes in antineoplastictherapy, including changes in hormonal therapy, in a subject. Insome embodiments, skeletal-related events sought to be treatedusing the methods provided herein and/or utilizing the compositionsprovided herein, comprise treating, suppressing, preventing,reducing the incidence of, or delaying progression or severity ofbone metastases, or bone loss. In one embodiment, bone loss maycomprise osteoporosis, osteopenia, or a combination thereof. In oneembodiment, skeletal-related events may comprise any combination ofthe embodiments listed herein.

In one embodiment, the skeletal-related events are a result ofcancer therapy. In one embodiment, the skeletal-related events area result of hormone deprivation therapy, while in anotherembodiment, they are a product of androgen deprivation therapy(ADT).

In another embodiment, the methods of the present inventioncomprise administering the SARM compound, in combination withbisphosphonates such as alendronate, tiludroate, clodroniate,pamidronate, etidronate, alendronate, zolendronate, cimadronate,neridronate, minodronic acid, ibandronate, risedronate, orhom*oresidronate for treating osteoporosis.

In another embodiment, the methods of the present inventioncomprise administering the SARM compound, in combination withcalcitonin such as salmon, Elcatonin.RTM., SUN-8577 or TJN-135 fortreating osteoporosis.

In another embodiment, the methods of treating osteoporosis of thepresent invention comprise administering the SARM compound, incombination with: a) vitamin D or derivative such as ZK-156979; b)vitamin D receptor ligand and analogues such as calcitriol,topitriol, ZK-150123, TEI-9647, BXL-628, Ro-26-9228, BAL-2299,Ro-65-2299 or DP-035; c) estrogen, estrogen derivative, orconjugated estrogens; d) antiestrogen, progestins, or syntheticestrogen/progestins; e) RANK ligand mAb such as denosumab formerlyAMG162 (Amgen); f) .alpha.v.beta.3 integrin receptor antagonist; g)osteoclast vacuolar ATPase inhibitor; h) antagonist of VEGF bindingto osteoclast receptors; i) calcium receptor antagonist; j) PTh(parathyroid hormone) and analogues, PTHrP analogues (parathyroidhormone-related peptide); k) cathepsin K inhibitors (AAE581, etc.);l) strontium ranelate; m) tibolone; n) HCT-1026, PSK3471; o)gallium maltolate; p) Nutropin AQ.RTM.; q) prostaglandins (forosteo); r) p38 protein kinase inhibitor; s) bone morphogeneticprotein; t) inhibitor of BMP antagonism; u) HMG-CoA reductaseinhibitor; v) vitamin K or derivative; w) ipriflavone x) fluoridesalts; y) dietary calcium supplement, or z) osteoprotegerin.

In one embodiment, the methods of this invention are useful intreating diseases or disorders caused by, or associated with ahormonal disorder, disruption or imbalance.

In one embodiment, the hormonal disorder, disruption or imbalancecomprises an excess of a hormone. In another embodiment, thehormonal disorder, disruption or imbalance comprises a deficiencyof a hormone. In one embodiment, the hormone is a steroid hormone.In another embodiment, the hormone is an estrogen. In anotherembodiment, the hormone is an androgen. In another embodiment, thehormone is a glucocorticoid. In another embodiment, the hormone isa cortico-steroid. In another embodiment, the hormone islu*teinizing hormone (LH). In another embodiment, the hormone isfollicle stimulating hormone (FSH). In another embodiment, thehormone is any other hormone known in the art. In anotherembodiment, the hormonal disorder, disruption or imbalance isassociated with menopause. In another embodiment, the hormonaldisorder, disruption or imbalance is associated with andropause,andropausal vasomotor symptoms, andropausal gynecomastia, musclestrength and/or function, bone strength and/or function and anger.In another embodiment, hormone deficiency is a result of specificmanipulation, as a byproduct of treating a disease or disorder inthe subject. For example, the hormone deficiency may be a result ofandrogen depletion in a subject, as a therapy for prostate cancerin the subject. Each possibility represents a separate embodimentof the present invention.

In another embodiment the invention is directed to treatingsarcopenia or cachexia, and associated conditions related thereto,for example diseases or disorders of the bone.

In one embodiment, this invention provides for the use of a SARMcompound as herein described, or its prodrug, analog, isomer,metabolite, derivative, acceptable salt, pharmaceutical product,polymorph, crystal, impurity, N-oxide, hydrate or any combinationthereof, for: 1) treating a muscle wasting disorder; 2) preventinga muscle wasting disorder; 3) treating, preventing, suppressing,inhibiting or reducing muscle loss due to a muscle wastingdisorder; 4) treating, preventing, inhibiting, reducing orsuppressing muscle wasting due to a muscle wasting disorder; 5)treating, preventing, inhibiting, reducing or suppressing muscleprotein catabolism due to a muscle wasting disorder, 6) treating,preventing, inhibiting, reducing or suppressing end stage renaldisease; and/or 7) treating, preventing, inhibiting, reducing orsuppressing frailty.

In some embodiments, the invention provides compositions comprisingthe compound of formula S-(III) or use of the compound of formulaS-(III) for treating bone disease and/or resorption, muscle wastingor diseases associated with muscle wasting, prostate cancer, and/orproviding hormonal therapy for androgen-dependent conditions,and/or end stage renal disease, frailty, and/or osteoporosis.

In another embodiment, the use of a SARM compound for treating asubject having a muscle wasting disorder, or any of the disordersdescribed herein, includes administering a pharmaceuticalcomposition including a SARM compound as herein described. Inanother embodiment, the administering step includes intravenously,intraarterially, or intramuscularly injecting to said subject saidpharmaceutical composition in liquid form; subcutaneouslyimplanting in said subject a pellet containing said pharmaceuticalcomposition; orally administering to said subject saidpharmaceutical composition in a liquid or solid form; or topicallyapplying to the skin surface of said subject said pharmaceuticalcomposition.

A muscle is a tissue of the body that primarily functions as asource of power. There are three types of muscles in the body: a)skeletal muscle--the muscle responsible for moving extremities andexternal areas of the bodies; b) cardiac muscle--the heart muscle;and c) smooth muscle--the muscle that is in the walls of arteriesand bowel.

A wasting condition or disorder is defined herein as a condition ordisorder that is characterized, at least in part, by an abnormal,progressive loss of body, organ or tissue mass. A wasting conditioncan occur as a result of a pathology such as, for example, cancer,or an infection, or it can be due to a physiologic or metabolicstate, such as disuse deconditioning that can occur, for example,due to prolonged bed rest or when a limb is immobilized, such as ina cast. A wasting condition can also be age associated. The loss ofbody mass that occurs during a wasting condition can becharacterized by a loss of total body weight, or a loss of organweight such as a loss of bone or muscle mass due to a decrease intissue protein.

In one embodiment, the terms "muscle wasting" or "muscularwasting", used herein interchangeably, refer to the progressiveloss of muscle mass and/or to the progressive weakening anddegeneration of muscles, including the skeletal or voluntarymuscles which control movement, cardiac muscles which control theheart, and smooth muscles. In one embodiment, the muscle wastingcondition or disorder is a chronic muscle wasting condition ordisorder. "Chronic muscle wasting" is defined herein as the chronic(i.e. persisting over a long period of time) progressive loss ofmuscle mass and/or to the chronic progressive weakening anddegeneration of muscle.

The term cachexia may be defined as a multifactoral syndromecharacterized by severe body weight, fat and muscle loss andincreased protein catabolism due to underlying disease(s). Cachexiais clinically relevant since it increases patients' morbidity andmortality. Contributory factors to the onset of cachexia areanorexia and metabolic alterations, i.e. increased inflammatorystatus, increased muscle proteolysis, impaired carbohydrate,protein and lipid metabolism

"Pre-cachexia" or "early cachexia" are defined based on thepresence of some or all of the following criteria: (a) underlyingchronic disease; (b) unintentional weight loss <5% of usual bodyweight during the last 6 months; (c) chronic or recurrent systemicinflammatory response; and (d) anorexia or anorexia-relatedsymptoms. Pre-cachexia or early cachexia may include thereforepatients with a chronic disease, small weight loss, and a chronicor recurrent systemic inflammatory disease and/or anorexia

Muscle wasting can occur as a result of pathology, disease,condition or disorders, including disorders for treatment via themethods of this invention, such as, for example, end stage renalfailure.

The loss of muscle mass that occurs during muscle wasting can becharacterized by a muscle protein breakdown or degradation, or bymuscle protein catabolism. Protein catabolism occurs because of anunusually high rate of protein degradation, an unusually low rateof protein synthesis, or a combination of both. Protein catabolismor depletion, whether caused by a high degree of proteindegradation or a low degree of protein synthesis, leads to adecrease in muscle mass and to muscle wasting. The term"catabolism" has its commonly known meaning in the art,specifically an energy burning form of metabolism.

Muscle wasting can occur as a result of a pathology, disease,condition or disorder. In one embodiment, the pathology, illness,disease or condition is chronic. In another embodiment, thepathology, illness, disease or condition is genetic. In anotherembodiment, the pathology, illness, disease or condition isneurological. In another embodiment, the pathology, illness,disease or condition is infectious. As described herein, thepathologies, diseases, conditions or disorders for which thecompounds and compositions of the present invention areadministered are those that directly or indirectly produce awasting (i.e. loss) of muscle mass, that is a muscle wastingdisorder.

In one embodiment, muscle wasting in a subject is a result of thesubject having a muscular dystrophy, muscle atrophy, or X-linkedspinal-bulbar muscular atrophy (SBMA).

In some embodiments, muscle loss or muscle wasting or cachexia in asubject results in reduced protein reserves, decreased strength andfunctional capacity, frailty, falls, reduced aerobic capacity,reduced energy requirements or increased mortality in patients andthe methods of this invention serve to treat these conditions, aswell, in the subject, via the administration of any embodiment of aSARM and/or composition as described herein.

In some embodiments, muscle loss or muscle wasting or cachexia in asubject results in increased dietary protein needs, inflammation(accelerated muscle protein breakdown), loss of motor units (agingCNS), reduced rate of muscle protein synthesis (post-prandial),and/or changing endocrine function (testosterone, estrogen, growthhormone, insulin resistance) and the methods of this inventionserve to treat these conditions, as well in the subject, via theadministration of any embodiment of a SARM and/or composition asdescribed herein.

In some embodiments, this invention provides methods for thetreating of sarcopenia and/or cachexia, via the administration ofany embodiment of a compound and/or composition as describedherein.

In some embodiments, treatment with a compound and/or compositionas described herein may provide for the increased rate of muscleprotein synthesis, increased muscle size and strength, improvedfunctional status in elderly people, increased independence forolder, frail people, increased insulin sensitivity, which in someembodiments is whereby such administration results in the treatmentof cachexia and/or sarcopenia or other disorders as describedherein. Muscle is the primary site for glucose metabolism, insulinresistance is largely a problem of resistance of muscle to insulin,resulting from increased lipid in muscle cells, increased totalfat, increased visceral fat, with the compounds and/or compositionsof this invention being useful to reduce total fat, therebyincreasing insulin sensitivity and/or reducing the risk of ortreating, etc., diabetes, as described herein.

The muscular dystrophies are genetic diseases characterized byprogressive weakness and degeneration of the skeletal or voluntarymuscles that control movement. The muscles of the heart and someother involuntary muscles are also affected in some form ofmuscular dystrophy. The nine forms of muscular dystrophy (MD) are:myotonic dystrophy, duch*enne muscular dystrophy, Becker musculardystrophy, lib-girdle muscular dystrophy, facioscapulhumeralmuscular dystrophy, congenital muscular dystrophy, oculopharyngealmuscular dystrophy, distal muscular dystrophy and Emery-Dreifussmuscular dystrophy.

Muscular dystrophy can affect people of all ages. Although someforms first become apparent in infancy or childhood, others may notappear until middle age or later. Myotonic dystrophy is the mostcommon of these diseases in adults. Myotonic dystrophy is anautosomal dominant genetic disease that occurs in 1/8000 people andis characterized by 2 types. Type I has a genetic defect in theDMPK gene whereas type II has a genetic defect in the CNBP gene.The mutation is an abnormal repeat of a DNA segment which presentsa disease phenotype of variable severity in the 2.sup.nd or3.sup.rd decade of life. Symptoms of the disease may include interalia prolonged contractions (myotonia) of certain muscles,cataracts, cardiac conduction defects, balding, or maleinfertility.

duch*enne MD is the most common form, typically affecting children.duch*enne muscular dystrophy includes weakness and degeneration ofskeletal and voluntary muscle which is exacerbated by high impactexercise, muscle contractures that worsen mobility if notcorrected, and scoliosis. Although braces and walkers provide someprotection, declines in physical function result in loss ofambulation during childhood leading to wheelchair confinement, andeventually impaired cardiac (cardiomyopathy) or respiratory(diaphragm fibrosis) function leads to death. Average lifeexpectancy has improved (and rare cases of men living into their4.sup.th or 5.sup.th decade) as a result of better respiratory(glucocorticoids) and cardiac (ACE inhibitors, angiotensin receptorblockers, and beta-blockers) supportive care but nodisease-modifying therapeutics exist.

Becker muscular dystrophy is a rarer and milder variation ofduch*enne muscular dystrophy caused by DMD mutants that do notcompletely abrogate dystrophin glycoprotein complex function inmales or more commonly is observed in some female carriers(duch*enne muscular dystrophy is often asymptomatic in females).

In one embodiment, this invention provides therapeutic effects ondystrophic skeletal, cardiac, and diaphragm muscles, or may delayonset or improve symptoms of loss of mobility/autonomy,cardiomyopathy, or respiratory insufficiency in duch*enne musculardystrophy or Becker muscular dystrophy and other muscular dystrophypatients; by administering the compound of this invention.

Muscle atrophy (MA) is characterized by wasting away or diminutionof muscle and a decrease in muscle mess. For example, post-polio MAis a muscle wasting that occurs as part of the post-polio syndrome(PPS). The atrophy includes weakness, muscle fatigue, and pain.

Another type of MA is X-linked spinal-bulbar muscular atrophy(SBMA--also known as Kennedy's Disease). This disease arises from adefect in the androgen receptor gee on the X chromosome, affectsonly males, and its onset is in adulthood. Because the primarydisease cause is an androgen receptor mutation, androgenreplacement is not a current therapeutic strategy. There are someinvestigational studies where exogenous testosterone propionate isbeing given to boost the levels of androgen with hopes ofovercoming androgen insensitivity and perhaps provide an anaboliceffect. Still, use of supraphysiological levels of testosterone forsupplementation will have limitations and other potentially seriouscomplications.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of duch*enne musculardystrophy in a subject in need thereof, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00040## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of duch*enne musculardystrophy in a subject in need thereof, comprising the step ofadministering a pharmaceutical composition comprising a selectiveandrogen receptor modulator (SARM) compound represented by thestructure of formula S-(III):

##STR00041## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof, and apharmaceutically acceptable carrier.

In another embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of duch*enne muscular dystrophy in asubject in need thereof, further increases the quality of life ofsaid subject. In another embodiment, the method of this inventionfor treating, reducing the severity, reducing the incidence,delaying the onset, or reducing the pathogenesis of duch*ennemuscular dystrophy in a subject in need thereof, further increasesthe survival of said subject. In another embodiment, the method ofthis invention for treating, reducing the severity, reducing theincidence, delaying the onset, or reducing the pathogenesis ofduch*enne muscular dystrophy in a subject in need thereof, furtherincreases the physical function of said subject. In anotherembodiment, the method of this invention for treating, reducing theseverity, reducing the incidence, delaying the onset, or reducingthe pathogenesis of duch*enne muscular dystrophy in a subject inneed thereof, further delays the loss of body weight of saidsubject. In another embodiment, the method of this invention fortreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of duch*enne musculardystrophy in a subject in need thereof, further delays loss ofambulation of said subject. In another embodiment, the method ofthis invention for treating, reducing the severity, reducing theincidence, delaying the onset, or reducing the pathogenesis ofduch*enne muscular dystrophy in a subject in need thereof, furtherdelays loss of lean body mass of said subject. In anotherembodiment, the method of this invention for treating, reducing theseverity, reducing the incidence, delaying the onset, or reducingthe pathogenesis of duch*enne muscular dystrophy in a subject inneed thereof, further delays the gain of fat body mass of saidsubject. In another embodiment, the method of this invention fortreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of duch*enne musculardystrophy in a subject in need thereof, further delays musclefibrosis of said subject. In another embodiment, the method of thisinvention for treating, reducing the severity, reducing theincidence, delaying the onset, or reducing the pathogenesis ofduch*enne muscular dystrophy in a subject in need thereof, furtherdelays cardiomyopathy of said subject. In another embodiment, themethod of this invention for treating, reducing the severity,reducing the incidence, delaying the onset, or reducing thepathogenesis of duch*enne muscular dystrophy in a subject in needthereof, further delays respiratory failure or insufficiency ofsaid subject. In another embodiment, the method of this inventionfor treating, reducing the severity, reducing the incidence,delaying the onset, or reducing the pathogenesis of duch*ennemuscular dystrophy in a subject in need thereof, further increasesthe exercise tolerance of said subject. In another embodiment, themethod of this invention for treating, reducing the severity,reducing the incidence, delaying the onset, or reducing thepathogenesis of duch*enne muscular dystrophy in a subject in needthereof, further decreases the extent and severity of musclecontractures of said subject. In another embodiment, the method ofthis invention for treating, reducing the severity, reducing theincidence, delaying the onset, or reducing the pathogenesis ofduch*enne muscular dystrophy in a subject in need thereof, furtherprevents or delays scoliosis of said subject.

In another embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of duch*enne muscular dystrophy in asubject in need thereof, further delays onset or improves symptomsof cardiomyopathy and/or respiratory function.

In one embodiment, this invention is directed to a method ofincreasing the physical function of a subject suffering fromduch*enne muscular dystrophy, comprising the step of administeringto said subject a selective androgen receptor modulator (SARM)compound represented by the structure of formula S-(III):

##STR00042## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method ofincreasing the quality of life of a subject suffering from duch*ennemuscular dystrophy, comprising the step of administering to saidsubject a selective androgen receptor modulator (SARM) compoundrepresented by the structure of formula S-(III):

##STR00043## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

The term "quality of life" refers herein to improvement of one ormore of the following: motor skills such as ambulation and limbstrength, less fatigue, delaying onset, treating, or preventingcardiopathies; delaying onset, treating, or preventing respiratorysymptoms and respiratory insufficiency or failure, or improvedcognition.

In one embodiment, this invention is directed to a method ofincreasing the survival of a subject suffering from duch*ennemuscular dystrophy, comprising the step of administering to saidsubject a selective androgen receptor modulator (SARM) compoundrepresented by the structure of formula S-(III):

##STR00044## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiomyopathy in a subjectsuffering from duch*enne muscular dystrophy, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00045## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiomyopathy in a subjectsuffering from duch*enne muscular dystrophy, further increases thequality of life of said subject. In another embodiment, the methodof this invention for treating, reducing the severity, reducing theincidence, delaying the onset, or reducing the pathogenesis ofcardiomyopathy in a subject suffering from duch*enne musculardystrophy, further increases the survival of said subject. Inanother embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiomyopathy a subject sufferingfrom duch*enne muscular dystrophy, further increases the physicalfunction of said subject.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of respiratory failure in a subjectsuffering from duch*enne muscular dystrophy, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00046## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of respiratory failure in a subjectsuffering from duch*enne muscular dystrophy, further increases thequality of life of said subject. In another embodiment, the methodof this invention for treating, reducing the severity, reducing theincidence, delaying the onset, or reducing the pathogenesis ofrespiratory failure in a subject suffering from duch*enne musculardystrophy, further increases the survival of said subject. Inanother embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of respiratory failure in a subjectsuffering from duch*enne muscular dystrophy, further increases thephysical function of said subject.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of Becker muscular dystrophy ormyotonic dystrophy in a subject in need thereof, comprising thestep of administering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00047##

or its isomer, pharmaceutically acceptable salt, hydrate, N-oxide,or any combination thereof.

In one embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of Becker muscular dystrophy ormyotonic dystrophy in a subject in need thereof, further increasesthe quality of life of said subject. In another embodiment, themethod of this invention for treating, reducing the severity,reducing the incidence, delaying the onset, or reducing thepathogenesis of Becker muscular dystrophy or myotonic dystrophy ina subject in need thereof, further increases the survival of saidsubject. In another embodiment, the method of this invention fortreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of Becker musculardystrophy or myotonic dystrophy in a subject in need thereof,further increases the physical function of said subject.

In another embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of Becker muscular dystrophy ormyotonic dystrophy in a subject in need thereof, further delaysonset or improves symptoms of cardiomyopathy and/or respiratoryfunction.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of myotonic dystrophy,limb-girdle muscular dystrophy, facioscapulhumeral musculardystrophy, congenital muscular dystrophy, oculopharyngeal musculardystrophy, distal muscular dystrophy, or Emery-Dreifuss musculardystrophy in a subject in need thereof, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00048## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of myotonic dystrophy in asubject in need thereof, comprising the step of administering tosaid subject a selective androgen receptor modulator (SARM)compound represented by the structure of formula S-(III):

##STR00049## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of limb-girdle musculardystrophy in a subject in need thereof, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00050## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of facioscapulhumeralmuscular dystrophy in a subject in need thereof, comprising thestep of administering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00051## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of congenital musculardystrophy in a subject in need thereof, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00052## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of oculopharyngeal musculardystrophy in a subject in need thereof, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00053## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of distal musculardystrophy in a subject in need thereof, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00054## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In one embodiment, this invention is directed to a method oftreating, reducing the severity, reducing the incidence, delayingthe onset, or reducing the pathogenesis of Emery-Dreifuss musculardystrophy in a subject in need thereof, comprising the step ofadministering to said subject a selective androgen receptormodulator (SARM) compound represented by the structure of formulaS-(III):

##STR00055## or its isomer, pharmaceutically acceptable salt,hydrate, N-oxide, or any combination thereof.

In another embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of myotonic dystrophy, limb-girdlemuscular dystrophy, facioscapulhumeral muscular dystrophy,congenital muscular dystrophy, oculopharyngeal muscular dystrophy,distal muscular dystrophy, or Emery-Dreifuss muscular dystrophy ina subject in need thereof, further increases the quality of life ofsaid subject. In another embodiment, the method of this inventionfor treating, reducing the severity, reducing the incidence,delaying the onset, or reducing the pathogenesis of myotonicdystrophy, limb-girdle muscular dystrophy, facioscapulhumeralmuscular dystrophy, congenital muscular dystrophy, oculopharyngealmuscular dystrophy, distal muscular dystrophy, or Emery-Dreifussmuscular dystrophy in a subject in need thereof, further increasesthe survival of said subject. In another embodiment, the method ofthis invention for treating, reducing the severity, reducing theincidence, delaying the onset, or reducing the pathogenesis ofmyotonic dystrophy, limb-girdle muscular dystrophy,facioscapulhumeral muscular dystrophy, congenital musculardystrophy, oculopharyngeal muscular dystrophy, distal musculardystrophy, or Emery-Dreifuss muscular dystrophy in a subject inneed thereof, further increases the physical function of saidsubject.

In another embodiment, the method of this invention for treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of myotonic dystrophy, limb-girdlemuscular dystrophy, facioscapulhumeral muscular dystrophy,congenital muscular dystrophy, oculopharyngeal muscular dystrophy,distal muscular dystrophy, or Emery-Dreifuss muscular dystrophy ina subject in need thereof, further delays onset or improvessymptoms of cardiomyopathy and/or respiratory function.

In one embodiment, this invention provides a method of treating,reducing the incidence of, delaying progression of, reducing theseverity of, or alleviating symptoms associated with a musclewasting disorder in a subject, comprising the step of administeringto said subject the selective androgen receptor modulator compoundof this invention or its isomer, pharmaceutically acceptable salt,pharmaceutical product, crystal, hydrate, N-oxide or anycombination thereof, or a composition comprising the same, in anamount effective to treat the muscle wasting disorder in saidsubject. In another embodiment, the compound is a compound offormula S-(III).

According to this aspect, and in one embodiment, the muscle wastingdisorder is due to a pathology, illness, disease or condition. Inone embodiment, the pathology, illness, disease or condition isneurological, infectious, chronic or genetic. In one embodiment,the pathology, illness, disease or condition is a musculardystrophy, a muscular atrophy, X-linked spinal-bulbar muscularatrophy (SBMA), a cachexia, malnutrition, leprosy, diabetes, renaldisease, chronic obstructive pulmonary disease (COPD), cancer, endstage renal failure, sarcopenia, emphysema, osteomalacia, HIVinfection, AIDS, or cardiomyopathy. In one embodiment, the compoundis a compound of this invention. In another embodiment, thecompound is a compound of formula S-(III).

In one embodiment, the muscle wasting disorder is an age-associatedmuscle wasting disorder, a disuse deconditioning-associated musclewasting disorder; or the muscle wasting disorder is due to chroniclower back pain, burns, central nervous system (CNS) injury ordamage, peripheral nerve injury or damage, spinal cord injury ordamage, chemical injury or damage, or alcoholism.

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiovascular disease in a humansubject, comprising the step of administering an effective amountof a compound of this invention or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to said subject. In another embodiment,the compound is a compound of formula S-(III).

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiovascular disease in a humansubject suffering from duch*enne muscular dystrophy comprising thestep of administering an effective amount of a compound of thisinvention or its isomer, pharmaceutically acceptable salt,pharmaceutical product, crystal, N-oxide, hydrate or anycombination thereof to said subject. In another embodiment, thecompound is a compound of formula S-(III).

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiovascular disease in a humansubject suffering from Becker muscular dystrophy comprising thestep of administering an effective amount of a compound of thisinvention or its isomer, pharmaceutically acceptable salt,pharmaceutical product, crystal, N-oxide, hydrate or anycombination thereof to said subject. In another embodiment, thecompound is a compound of formula S-(III).

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cardiovascular disease in a humansubject suffering from myotonic dystrophy comprising the step ofadministering an effective amount of a compound of this inventionor its isomer, pharmaceutically acceptable salt, pharmaceuticalproduct, crystal, N-oxide, hydrate or any combination thereof tosaid subject. In another embodiment, the compound is a compound offormula S-(III).

In one embodiment, this invention provides a method of treating,reducing the severity, reducing the incidence, delaying the onset,or reducing the pathogenesis of cachexia in a subject, comprisingthe step of administering an effective amount of a compound of thisinvention or its isomer, pharmaceutically acceptable salt,pharmaceutical product, crystal, N-oxide, hydrate or anycombination thereof to said subject. In one embodiment, thecompound is of formula S-(III).

In one embodiment, the present invention provides a method ofreducing a fat mass in a subject comprising the step ofadministering an effective amount of a compound of this inventionor its isomer, pharmaceutically acceptable salt, pharmaceuticalproduct, crystal, N-oxide, hydrate or any combination thereof tothe subject. In another embodiment, the compound is a compound offormula S-(III).

In one embodiment, the present invention provides a method ofreducing a fat mass in a subject suffering from duch*enne musculardystrophy comprising the step of administering an effective amountof a compound of this invention or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject. In another embodiment,the compound is a compound of formula S-(III). In one embodiment,the present invention provides a method of reducing or preventingfibrosis in a subject suffering from duch*enne muscular dystrophycomprising the step of administering an effective amount of acompound of formula (I) or its isomer, pharmaceutically acceptablesalt, pharmaceutical product, crystal, N-oxide, hydrate or anycombination thereof to the subject.

In one embodiment, the present invention provides a method ofreducing a fat mass in a subject suffering from Becker musculardystrophy comprising the step of administering an effective amountof a compound of this invention or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject. In another embodiment,the compound is a compound of formula S-(III). In one embodiment,the present invention provides a method of reducing or preventingfibrosis in a subject suffering from Becker muscular dystrophycomprising the step of administering an effective amount of acompound of formula (I) or its isomer, pharmaceutically acceptablesalt, pharmaceutical product, crystal, N-oxide, hydrate or anycombination thereof to the subject.

In one embodiment, the present invention provides a method ofreducing a fat mass in a subject suffering from myotonic dystrophycomprising the step of administering an effective amount of acompound of this invention or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject. In another embodiment,the compound is a compound of formula S-(III). In one embodiment,the present invention provides a method of reducing or preventingfibrosis in a subject suffering from myotonic dystrophy comprisingthe step of administering an effective amount of a compound offormula (I) or its isomer, pharmaceutically acceptable salt,pharmaceutical product, crystal, N-oxide, hydrate or anycombination thereof to the subject.

In one embodiment, the present invention provides a method ofincreasing a lean mass in a subject comprising the step ofadministering an effective amount of a compound of this inventionor its isomer, pharmaceutically acceptable salt, pharmaceuticalproduct, crystal, N-oxide, hydrate or any combination thereof tothe subject. In another embodiment, the compound is a compound offormula S-(III).

In one embodiment, the present invention provides a method ofincreasing a lean mass in a subject suffering from duch*ennemuscular dystrophy comprising the step of administering aneffective amount of a compound of this invention or its isomer,pharmaceutically acceptable salt, pharmaceutical product, crystal,N-oxide, hydrate or any combination thereof to the subject. Inanother embodiment, the compound is a compound of formulaS-(III).

In one embodiment, the present invention provides a method ofincreasing a lean mass in a subject suffering from Becker musculardystrophy comprising the step of administering an effective amountof a compound of this invention or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject. In another embodiment,the compound is a compound of formula S-(III).

In one embodiment, the present invention provides a method ofincreasing a lean mass in a subject suffering from myotonicdystrophy comprising the step of administering an effective amountof a compound of this invention or its isomer, pharmaceuticallyacceptable salt, pharmaceutical product, crystal, N-oxide, hydrateor any combination thereof to the subject. In another embodiment,the compound is a compound of formula S-(III).

In another embodiment, this invention provides a method oftreating, reducing the incidence of, delaying progression of,reducing the severity of, or alleviating symptoms associated with amuscle wasting disorder; reducing a fat mass; or increasing a leanmass in a subject, comprising the step of administering aneffective amount of a compound of this invention or its isomer,pharmaceutically acceptable salt, pharmaceutical product, crystal,N-oxide, hydrate or any combination thereof to the subject asherein described. In another embodiment, the compound is a compoundof formula S-(III).

Sarcopenia is a debilitating disease that afflicts the elderly andchronically ill patients and is characterized by loss of musclemass and function. Further, increased lean body mass is associatedwith decreased morbidity and mortality for certain muscle-wastingdisorders. In addition, other circ*mstances and conditions arelinked to, and can cause muscle wasting disorders. For example,studies have shown that in severe cases of chronic lower back pain,there is paraspinal muscle wasting.

Muscle wasting and other tissue wasting is also associated withadvanced age. It is believed that general weakness in old age isdue to muscle wasting. As the body ages, an increasing proportionof skeletal muscle is replaced by fibrous tissue. The result is asignificant reduction in muscle power, performance andendurance.

Long term hospitalization due to illness or injury, or disusedeconditioning that occurs, for example, when a limb isimmobilized, can also lead to muscle wasting, or wasting of othertissue. Studies have shown that in patients suffering injuries,chronic illnesses, burns, trauma or cancer, who are hospitalizedfor long periods of time, there is a long-lasting unilateral musclewasting, and a decrease in body mass.

Injuries or damage to the central nervous system (CNS) are alsoassociated with muscle wasting and other wasting disorders.Injuries or damage to the CNS can be, for example, caused bydiseases, trauma or chemicals. Examples are central nerve injury ordamage, peripheral nerve injury or damage and spinal cord injury ordamage. In one embodiment CNS damage or injury comprise Alzheimer'sdiseases (AD), anger (mood), anorexia, anorexia nervosa, anorexiaassociated with aging and/or assertiveness (mood).

In another embodiment, muscle wasting or other tissue wasting maybe a result of alcoholism, and may be treated with the compoundsand compositions of the invention, representing embodimentsthereof.

In one embodiment, the invention provides a use of SARM compound asdescribed herein or its prodrug, analog, isomer, metabolite,derivative, pharmaceutically acceptable salt, pharmaceuticalproduct, polymorph, crystal, impurity, N-oxide, hydrate or anycombination thereof for the treatment of a wasting disease,disorder or condition in a subject.

In one embodiment, the wasting disease, disorder or condition beingtreated is associated with chronic illness

This invention is directed to treating, in some embodiments, anywasting disorder, which may be reflected in muscle wasting, weightloss, malnutrition, starvation, or any wasting or loss offunctioning due to a loss of tissue mass.

In some embodiments, wasting diseases or disorders, such ascachexia, malnutrition, tuberculosis, leprosy, diabetes, renaldisease, chronic obstructive pulmonary disease (COPD), cancer, endstage renal failure, sarcopenia, emphysema, osteomalacia, orcardiomyopathy, may be treated by the methods of this invention,via the administration of a SARM compound as herein described,compositions comprising the same, with or without additional drugs,compounds, or agents, which provide a therapeutic effect for thecondition being treated.

In some embodiments, wasting is due to infection with enterovirus,Epstein-Barr virus, herpes zoster, HIV, trypanosomes, influenza,coxsackie, rickettsia, trichinella, schistosoma or mycobacteria,and this invention, in some embodiments, provides methods oftreatment thereof.

Cachexia is weakness and a loss of weight caused by a disease or asa side effect of illness. Cardiac cachexia, i.e. a muscle proteinwasting of both the cardiac and skeletal muscle, is acharacteristic of congestive heart failure. Cancer cachexia is asyndrome that occurs in patients with solid tumors andhematological malignancies and is manifested by weight loss withmassive depletion of both adipose tissue and lean muscle mass.

Cachexia is also seen in acquired immunodeficiency syndrome (AIDS),human immunodeficiency virus (HIV)-associated myopathy and/ormuscle weakness/wasting is a relatively common clinicalmanifestation of AIDS. Individuals with HIV-associated myopathy ormuscle weakness or wasting typically experience significant weightloss, generalized or proximal muscle weakness, tenderness, andmuscle atrophy.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith an infection in a subject. In one embodiment, the methodcomprises administering to a subject a composition comprising aSARM compound and an immunomodulating agent, an anti-infectiveagent, a gene therapy agent, or a combination thereof. In someembodiments, infections comprise actinomycosis, anaplasmosis,anthrax, aspergillosis, bacteremia, bacterial mycoses, bartonellainfections, botulism, brucellosis, burkholderia infections,campylobacter infections, candidiasis, cat-scratch disease,chlamydia infections, cholera, clostridium infections,coccidioidomycosis, cross infection, cryptococcosis,dermatomycoses, diphtheria, ehrlichiosis, Escherichia coliinfections, fasciitis, necrotizing, Fusobacterium infections, gasgangrene, gram-negative bacterial infections, gram-positivebacterial infections, histoplasmosis, impetigo, Klebsiellainfections, legionellosis, leprosy, leptospirosis, Listeriainfections, lyme disease, maduromycosis, melioidosis, mycobacteriuminfections, mycoplasma infections, mycoses, nocardia infections,onychomycosis, plague, pneumococcal infections, pseudomonasinfections, psittacosis, q fever, rat-bite fever, relapsing fever,rheumatic fever, Rickettsia infections, rocky mountain spottedfever, salmonella infections, scarlet fever, scrub typhus, sepsis,sexually transmitted diseases, Staphylococcal infections,Streptococcal infections, tetanus, tick-borne diseases,tuberculosis, tularemia, typhoid fever, typhus, louse-borne, vibrioinfections, yaws, yersinia infections, zoonoses, zygomycosis,acquired immunodeficiency syndrome, adenoviridae infections,alphavirus infections, arbovirus infections, borna disease,bunyaviridae infections, caliciviridae infections, chickenpox,coronaviridae infections, coxsackievirus infections,cytomegalovirus infections, dengue, DNA virus infections, ecthyma,contagious, encephalitis, arbovirus, Epstein-berr virus infections,erythema infectiosum, hantavirus infections, hemorrhagic fevers,viral hepatitis, viral human herpes simplex, herpes zoster, herpeszoster oticus, herpesviridae infection, infectious mononucleosis,human-lassa fever, measles, molluscum, contagiosum, mumps,paramyxoviridae infections, phlebotomus fever, polyomavirusinfections, rabies, respiratory syncytial virus infections, riftvalley fever, RNA virus infections, rubella, slow virus diseases,smallpox, subacute sclerosing panencephalitis, tumor virusinfections, warts, west nile fever, virus diseases, yellow fever,amebiasis, anisakiasis, ascariasis, babesiosis, blastocystishominis infections, bug bite, cestode infections, chagas disease,cryptosporidiosis, cyclosporiasis, cysticercosis, dientamoebiasis,diphyllobothriasis, dracunculiasis, echinococcosis, ectoparasiticinfestations, filariasis, giardiasis, helminthiasis, hookworminfections, larva migrans, leishmaniasis, lice infestations,loiasis, malaria, mite infestations, myiasis, onchocerciasis,protozoan infections, scabies, schistosomiasis, skin diseases,parasitic, strongyloidiasis, taeniasis, toxocariasis,toxoplasmosis, trichinosis, trichom*onas infections,trypanosomiasis, trypanosomiasis, african, or whipworminfections.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a musculoskeletal disease in a subject. In some embodiments,musculoskeletal diseases comprise achondroplasia, acquiredhyperostosis syndrome, acrocephalosyndactylia, arthritis,arthrogryposis, arthropathy, neurogenic bursitis, cartilagediseases, cleidocranial dysplasia, clubfoot, compartment syndromes,craniofacial dysostosis, craniosynostoses, dermatomyositis,Dupuytren's contracture, dwarfism, Ellis Van Creveld syndrome,enchondromatosis, eosinophilia-myalgia syndrome, exostoses,fasciitis, fatigue syndrome, fibromyalgia, fibrous dysplasia ofbone, fibrous dysplasia, polyostotic, flatfoot, foot deformities,Freiberg's disease, funnel chest, Goldenhar syndrome, gout, halluxvalgus, hip dislocation, hyperostosis, intervertebral diskdisplacement, kabuki make-up syndrome, Klippel-Feil syndrome,Langer-Giedion syndrome, Legg-Perthes disease, lordosis,mandibulofacial dysostosis, melorheostosis, mitochondrialmyopathies, muscle cramp, muscle spasticity, muscular dystrophies,musculoskeletal abnormalities, musculoskeletal diseases, myositis,myositis ossificans, myotubular myopathy, osteitis deformans,osteoarthritis, osteochondritis, osteogenesis imperfecta,osteomyelitis, osteonecrosis, osteopetrosis, osteoporosis, polandsyndrome, polychondritis, relapsing, polymyalgia rheumatica,polymyositis, rhabdomyolysis, rheumatic diseases, Russel silversyndrome, Scheuermannn's disease, scoliosis, Sever'sdisease/calceneal apophysitis, spinal diseases, spinalosteophytosis, spinal stenosis, spondylitis, ankylosing,spondylolisthesis, sprengel's deformity, synovitis, tendinopathy,tennis elbow, tenosynovitis, thanatophoric dysplasia, or Tietze'ssyndrome.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a digestive system disease in a subject. In some embodiments,gastrointestinal diseases comprise adenomatous polyposis coli,Alagille syndrome, anus diseases, appendicitis, Barrett esophagus,biliary atresia, biliary tract diseases, Caroli disease, celiacdisease, cholangias, cholecystitis, cholelithiasis, colitis,ulcerative, Crohn's disease, deglutition disorders, duodenal ulcer,dysentery, enterocolitis, pseudomembranous, esophageal achalasiaesophageal atresia, esophagitis, exocrine pancreatic insufficiency,fatty liver, fecal incontinence, gastritis, gastritis,hypertrophic, gastroenteritis, gastroesophageal reflux,gastroparesis, hemorrhoids, hepatic vein thrombosis, hepatitis,hepatitis, chronic, hernia, diaphragmatic, hernia, hiatal,Hirschsprung disease, hypertension, portal, inflammatory boweldiseases, intestinal diseases, intestinal neoplasms, intestinalneuronal dysplasia, intestinal obstruction, irritable bowelsyndrome, lactose intolerance, liver cirrhosis, liver diseases,meckel diverticulum, pancreatic diseases, pancreatic neoplasms,pancreatitis, peptic ulcer, Peutz-Jeghers syndrome, proctitis,rectal diseases, rectal prolapse, short bowel syndrome,tracheoesophageal fistula, whipple disease, or Zollinger-Ellisonsyndrome.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a stomatognathic disease in a subject. In some embodiments,stomatognathic diseases comprise ankylogossia, bruxism, burningmouth syndrome, cheilitis, cherubism, cleft lip, dentigerous cyst,gingivitis, glossitis, benign migratory, herpes labials, Ludwig'sangina, macroglossia, Melkersson-Rosenthal syndrome, periodontaldiseases, Pierre Robin syndrome, prognathism, salivary glanddiseases, sialorrhea, stomatitis, aphthous, temporomandibular jointdisorders, temporomandibular joint dysfunction syndrome, orxerostomia.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a respiratory tract disease in a subject. In some embodiments,respiratory tract diseases comprise airway obstruction, apnea,asbestosis, asthma, atelectasis, berylliosis, bronchial diseases,bronchiectasis, bronchiolitis, bronchiolitis obliterans organizingpneumonia, bronchitis, bronchopulmonary dysplasia, common cold,cough, respiratory failure secondary to duch*enne musculardystrophy, empyema, pleural, epiglottitis, hemoptysis,hypertension, pulmonary, hyperventilation, Kartagener syndrome,lung abscess, lung diseases, meconium aspiration syndrome, pleuraleffusion, pleurisy, pneumonia, pneumothorax, pulmonary alveolarproteinosis, pulmonary disease, chronic obstructive, pulmonaryedema, pulmonary embolism, pulmonary emphysema, pulmonary fibrosis,respiratory distress syndrome, newborn-respiratoryhypersensitivity, respiratory tract infections, rhinoscleroma,scimitar syndrome, severe acute respiratory syndrome, silicosis,sleep apnea, central stridor, tracheal stenosis, Wegener'sgranulomatosis, or whooping cough.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith an otorhinolaryngologic disease in a subject. In someembodiments, otorhinolaryngologic diseases comprise cholesteatoma,middle ear, croup, deafness, epistaxis, hearing loss, hyperacusis,labyrinthitis, laryngitis, laryngomalacia, laryngostenosis,mastoiditis, Meniere's disease, nasal obstruction, nasal polyps,otitis, otorhinolayngologic diseases, otosclerosis, pharyngitis,presbycusis, retropharyngeal abscess, rhinitis, sinusitis,tinnitus, tonsillitis, tympanic membrane perforation, vestibularneuronitis, vocal cord paralysis, or voice disorders.

In some embodiments, the preset invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a nervous system disease in a subject. In some embodiments,nervous system diseases comprise autonomic nervous system diseases,central nervous system diseases, cranial nerve diseases,demyelinating diseases, nervous system malformations, neurologicmanifestations, or neuromuscular diseases.

In some embodiments, autonomic nervous system diseases comprisecausalgia, or reflex sympathetic dystrophy.

In some embodiments, central nervous system diseases compriseAlzheimer's disease, arachnoiditis, train abscess, brain ischemia,central nervous system infections, cerebral palsy, cerebrovasculardisorders, corticobasal ganglionic degeneration (CBGD),Creutzfeldt-Jakob syndrome, Dandy-Walker syndrome, dementia,encephalitis, encephalomyelitis, epilepsy, epilepsy inducedhypogonadal and/or hypermetabolic state, essential tremor,Friedreich ataxia, Gerstmann-Straussler-Sheinker disease,Hallervorden-Spatz syndrome, Huntington disease, hydrocephalus,hypoxia, insomnia, ischemic attack, kuru, Landau-Kleffner syndrome,Lewy Body disease, Machado-Joseph disease, meige syndrome,meningitis, bacterial meningitis, viral, migraine disorders,movement disorders, multiple system atrophy, myelitis,olivopontocerebellar atrophies, Parkinson's disease, parkinsoniandisorders, poliomyelitis, postpoliomyelitis syndrome, priondiseases, pseudotumor cerebri, Shy-Drager syndrome, spasms,infantile, spinal cord diseases, supranuclear palsy, syringomyelia,thalamic diseases, tic disorders, tourette syndrome, oruveomeningoencephalitic syndrome. In some embodiments, the centralnervous system disease is cystic fibrosis induced hypogonadalstate.

In some embodiments, cranial nerve diseases comprise bell palsy,cranial nerve diseases, facial hemiatrophy, facial neuralgia,glossopharyngeal nerve diseases, Moebius syndrome, or trigeminalneuraglia.

In some embodiments, central nervous system diseases compriseinjuries or damage to the central nervous system (CNS). In someembodiments, injuries or damage to the CNS may be associated withmuscle wasting disorders. Injuries or damage to the CNS can be, forexample, caused by diseases, trauma or chemicals. Examples arecentral nerve injury or damage, peripheral nerve injury or damageand spinal cord injury or damage.

Studies involving patients with spinal cord injuries (SCI) haveshown that central neurotransmitters may be altered after SQcausing hypothalamus-pituitary-adrenal axis dysfunction, whosedisruption led to a significant decrease in testosterone and otherhormone levels. SC or other acute illness or traumacharacteristically includes heightened catabolism in conjunctionwith the lowered anabolic activity resulting in a condition that isprone to loss of lean body tissue, which is often accompanied bydisturbed nutrient utilization. The effects of the loss of leanbody mass include the development of wounds and impaired healingmechanisms, further compounding the problem. Because of poornutrition and protein combined with immobilization, patients withspinal cord injury are at high risk for bed sores.

In one embodiment, a wide variety of injuries of the CNS may betreated by the methods of the present invention. CNS injury mayrefer, in one embodiment, to a breakdown of the membrane of a nervecell, or, in another embodiment, to the inability of the nerve toproduce and propagate nerve impulses, or in another embodiment, tothe death of the cell. An injury includes damage that directly orindirectly affects the normal functioning of the CNS. The injurymay be a structural, physical, or mechanical impairment and may becaused by physical impact, as in the case of a crushing,compression, or stretching of nerve fibers. Alternatively, the cellmembrane may be destroyed by or degraded by an illness, a chemicalimbalance, or a physiological malfunction such as anoxia (e.g.,stroke), aneurysm, or reperfusion. A CNS injury includes, forexample and without limitation, damage to retinal ganglion cells, atraumatic brain injury, a stroke-related injury, a cerebralaneurism-related injury, a spinal cord injury, includingmonoplegia, diplegia, paraplegia, hemiplegia and quadriplegia, aneuroproliferative disorder, or neuropathic pain syndrome.

With injury to the spinal cord of a mammal, connections betweennerves in the spinal cord are broken. Such injuries block the flowof nerve impulses for the nerve tracts affected by the injury, witha resulting impairment to both sensory and motor function. Injuriesto the spinal cord may arise from compression or other contusion ofthe spinal cord, or a crushing or severing of the spinal cord. Asevering of the spinal cord, also referred to herein as a"transection." may be a complete severing or, may be an incompletesevering of the spinal cord.

In some embodiments, the methods of treating a subject sufferingfrom a CNS injury or, in other embodiments, spinal cord injury, maybe accompanied by treatment of the subject with electricalstimulation of the injured site and the administration of a purinenucleoside, or analog thereof, for example as described in UnitedStates Patent Application Publication Number 20040214790A1.

In some embodiments, demyelinating diseases compriseadrenoleukodystrophy, alexander disease, canavan disease,demyelinating disease, diffuse cerebral sclerosis of schilder,leukodystrophy-globoid cell, leukodystrophy-metachromatic, multiplesclerosis, or neuromyelitis optica.

In some embodiments, nervous system malformations compriseArnold-Chiari malformation, Charcot-Marie-Tooth disease,encephalocele, hereditary motor and sensory neuropathies,septo-optic dysplasia, spina bifida occulta, or spinaldysraphism.

In some embodiments, neurologic manifestations comprise agnosia,amnesia, anomia, aphasia, apraxias, back pain, Brown-Sequardsyndrome, cerebellar ataxia, chorea, communication disorders,confusion, dizziness, dyslexia, dystonia, facial paralysis,fasciculation, gait disorders, neurologic-headache, herniplegia,memory disorders, mental retardation, mutism, myoclonus, neck pain,nonverbal learning disorder, olfaction disorders, pain, paralysis,phantom limb, prosopagnosia, quadriplegia, seizures, spasm, speechdisorders, synesthesia tardive dyskinesia, taste disorders,torticollis, tremor, trismus, unconsciousness, or vertigo.

In some embodiments, neuromuscular diseases comprise amyotrophiclateral sclerosis, brachial plexus neuritis, brachial plexusneuropathies, bulber palsy, carpal tunnel syndrome, cubital tunnelsyndrome, diabetic neuropathies, dysautonomia, Guillain, Baresyndrome, hereditary sensory and autonomic neuropathies, MillerFisher syndrome, motor neuron disease, muscular atrophy, spinal,myasthenia gravis, myopathies structural, congenital, nervecompression syndromes, neuralgia, neuromuscular diseases,paralyses, familial periodic, peripheral nervous system diseases,poems syndrome, polyneuropathies, polyradiculopathy, refsumdisease, sciatica, spinal muscular atrophies of childhood,stiff-person syndrome, thoracic outlet syndrome, or ulnar nervecompression syndromes.

In one embodiment, methods of treating a subject with a nervoussystem disease encompass treating any secondary conditions in thesubject, which arise due to the subject having a nervous systemdisease, some of which are described herein.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith an ophthalmic disease in a subject. In some embodimentsophthalmic disease comprise acute zonal occult outer retinopathy,Adie syndrome, albinism, ocular-amaurosis, fugax, amblyopia,aniridia, anisocoria, anopithalmos, aphakia, astigmatism,blepharitis, blepharoptosis, blepharospasm, blindness, cataract,chalazion, chorioretinitis, choroideremia, coloboma, color visiondefects, conjunctivitis, corneal diseases, corneal dystrophies,corneal edema, corneal ulcer, diabetic retinopathy, diplopia,distichiasis, dry eye syndromes, Duane retraction syndrome,ectropion, entropion, esotropia, exfoliation syndrome, exotropia,eye hemorrhage, eye neoplasms, eyelid diseases, floaters, generalfibrosis syndrome, glaucoma, gyrate atrophy, hemianopsia,Hermanski-Pudlak syndrome, hordeolum, Homer syndrome, hyperopia,hyphema, iritis, Kearns-Sayer syndrome, keratitis, keratoconus,lachrymal apparatus diseases, lacrimal duct obstruction, lensdiseases, macular degeneration, microphthalmos, myopia, nystagmus,pathologic, ocular motility disorders, oculomotor nerve diseases,ophthalmoplegia, optic atrophies, optic nerve diseases, opticneuritis, optic neuropathy, orbital cellulitis papilledema, Peter'sanomaly, presbyopia, pterygium, pupil disorders, refractive errors,retinal detachment, retinal diseases, retinal vein occlusion,retinitis pigmentosa, retinopathy of prematurity, retnoschisis,scleritis, scotoma, strabismns, Thygeson's superficial punctuatekeratitis, trachoma, uveitis, white dot syndrome, vision disorders,or vitreous disorders

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset or progressionor reducing and/or abrogating the symptoms associated with anurologic and/or male genital disease in a subject. In someembodiments, an urologic and/or male genital diseases compriseanti-glomerular basem*nt membrane disease, balanitis, bladderexstrophy, bladder neoplasms, cryptorchidism, cystitis,interstitial, diabetes insipidus, nephrogenic, epididymitis,fournier gangrene, glomerulonephritis, Goodpasture syndrome,hematospermia, hematuria, hemolytic-uremic syndrome,hydronephrosis, hypospadias, impotence, infertility, kidneycalculi, kidney failure, acute, kidney failure, chronic, kidneytubular necrosis, acute, medullary sponge kidney, multicysticdysplastic kidney, nephritis, hereditary, nephrosis, nephroticsyndrome, nocturia, oliguria, penile diseases, penile induration,penile neoplasms, phimosis, priapism, prostatic diseases, benignprostate hyperplasia, prostatic neoplasms, proteinuriapyelonephritis, Reiter disease, renal artery obstruction, spermaticcord torsion, testicular diseases, urethral stricture, urethritis,urinary retention, urinary tract infections, urination disorders,urologic and male genital diseases, urologic diseases, varicocele,vesico, or urethral reflux.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a dermatological disorder in a subject. In some embodiments,dermatological disorders comprise acne, actinic keratosis,alopecia, androgenic alopecia, alopecia areata, alopecia secondaryto chemotherapy, alopecia secondary to radiation therapy, alopeciainduced by scarring, alopecia induced by stress, angioma, athlete'sfoot, aquagenic pruritus, atopic dermatitis, baldness, basal cellcarcinoma, bed sore, Behcet's disease, blepharitis, boil, Bowen'sdisease, bullous pemphigoid, canker sore, carbuncles, cellulitis,chloracne, chronic dermatitis of the hands and feet, dyshidrosis,cold sores, contact dermatitis, creeping eruption, dandruff,dermatitis, dermatitis herpetiformis, dermatofixbroma, diaper rash,eczema, epidermolysis bullosa, erysipelas, erythroderma, frictionblister, genital wart, hidradenitis, suppurativa, hives,hyperhidrosis, ichthyosis, impetigo, jock itch, Kaposi's sarcoma,keloid, keratoacanthoma, keratois pilaris, lice infection, lichenplanus, lichen simplex chronicus, lipoma, lymphadenitis, malignantmelanoma, melasma, miliaria, molluscum contagiosum, nummulardermatitis, Paget's disease of the nipple, pediculosis, pemphigus,perioral dermatitis, photoallergy, photosensitivity, pityriasisrosea, pityriasis rubra pilaris, psoriasis, raynaud's disease, ringworm rosacea, scabies, scleroderma, sebaceous cyst, seborrheickeratosis, seborrhoeic dermatitis, shingles, skin cancer, skintags, spider veins, squamous cell carcinoma, stasis dermatitis,tick bite, tinea barbae, tinea capitis, tinea corporis, tineacruris, tinea pedis, tinea unguium, tinea versicolor, tinea,tungiasis, vitiligo, or warts.

In one embodiment, the dermatological disorder is a wound or aburn. In some embodiments, wounds and/or ulcers are foundprotruding from the skin or on a mucosal surface or as a result ofan infarction in an organ. A wound may be a result of a sot tissuedefect or a lesion or of an underlying condition. In oneembodiment, the term "wound" denotes a bodily injury withdisruption of the normal integrity of tissue structures. The termis also intended to encompass the terms "sore", "lesion","necrosis" and "ulcer". In one embodiment, the term "sore" refersto any lesion of the skin or mucous membranes and the term "ulcer"refers to a local defect, or excavation, of the surface of an organor tissue, which is produced by the sloughing of necrotic tissue.Lesion generally relates to any tissue defect. Necrosis is relatedto dead tissue resulting from infection, injury, inflammation orinfarctions. All of these are encompassed by the term "wound",which denotes any wound at any particular stage in the healingprocess including the stage before any healing has initiated oreven before a specific wound like a surgical incision is made(prophylactic treatment).

Examples of wounds which can be prevented and/or treated inaccordance with the present invention are, e.g., aseptic wounds,contused wounds, incised wounds, lacerated wounds, non-penetratingwounds (i.e. wounds in which there is no disruption of the skin butthere is injury to underlying structures), open wounds, penetratingwounds, perforating wounds, puncture wounds, septic wounds,subcutaneous wounds, etc. Examples of sores are bed sores, cankersores, chrome sores, cold sores, pressure sores etc. Examples ofulcers are, e.g., peptic ulcer, duodenal ulcer, gastric ulcer,gouty ulcer, diabetic ulcer, hypertensive ischemic ulcer, stasisulcer, ulcus cruris (venous ulcer), sublingual ulcer, submucousulcer, symptomatic ulcer, trophic ulcer, tropical ulcer, veneralulcer, e.g. caused by gonorrhoea (including urethritis,endocervicitis and proctitis). Conditions related to wounds orsores which may be successfully treated according to the inventionare burns, anthrax, tetanus, gas gangrene, scalatina, erysipelas,sycosis barbae, folliculitis, impetigo contagiosa, or impetigobullosa, etc. There is often a certain overlap between the use ofthe terms "wound" and "ulcer" and "wound" and "sore" and,furthermore, the terms are often used at random. Therefore asmentioned above, in the present context the term "wounds"encompasses the term "ulcer", "lesion", "sore" and "infarction",and the terms are indiscriminately used unless otherwiseindicated.

The kinds of wounds to be treated according to the inventioninclude also: i) general wounds such as, e.g., surgical, traumatic,infectious, ischemic, thermal, chemical and bullous wounds; ii)wounds specific for the oral cavity such as, e.g., post-extractionwounds, endodontic wounds especially in connection with treatmentof cysts and abscesses, ulcers and lesions of bacterial, vial orautoimmunological origin mechanical, chemical, thermal infectiousand lichenoid wounds; herpes ulcers, stomatitis aphthosa, acutenecrotising ulcerative gingivitis and burning mouth syndrome arespecific examples: and iii) wounds on the skin such as, e.g.,neoplasm, burns (e.g. chemical, thermal), lesions (bacterial,viral, autoimmunological), bites and surgical incisions. Anotherway of classifying wounds is as: i) small tissue loss due tosurgical incisions, minor abrasions and minor bites, or as ii)significant tissue loss. The latter group includes ischemic ulcers,pressure sores, fistulae, lacerations, severe bites, thermal burnsand donor site wounds (in soft and hard tissues) andinfarctions.

In other aspects of the invention, the wound to be prevented and/ortreated is selected from the group consisting of aseptic wounds,infarctions, contused wounds, incised wounds, lacerated wounds,non-penetrating wounds, open wounds, penetrating wounds,perforating wounds, puncture wounds, septic wounds and subcutaneouswounds.

Other wounds which are of importance in connection with the presentinvention are wounds like ischemic ulcers, pressure sores,fistulae, severe bites, thermal burns and donor site wounds.

In one embodiment, the use of the SARM compounds as describedherein and/or compositions are useful in wound healing as anadjunct to physical therapy/rehabilitation, as an anabolic agent.In another embodiment, the compositions as described herein areuseful in promoting healing of anterior cruciate ligament (ACL) ormedial cruciate ligament (MCL) injuries, or accelerating recoveryafter ACL or MCL surgery. In another embodiment, the compositionsas described herein are useful in enhancing athletic performance.In another embodiment, the compositions as described herein areuseful in treating burns. In another embodiment, the compositionsas described herein are useful in stimulating cartilage regrowth.In another embodiment, the compositions as described herein areuseful in preventing, treating, or reversing of catabolismassociated with prolonged critical illness, pulmonary dysfunction,ventilator dependency, aging, AIDS, trauma, surgery, congestiveheart failure, cardiac myopathy, burns, cancer, COPD). In anotherembodiment, the compositions as described herein are useful inpreventing or revering protein catabolism due to trauma. In anotherembodiment, the compositions as described herein are useful as: a)adjunct to cauterization therapy (laser or radio) as is used insurgery to promote wound healing, b) adjunct to cryotherapy topromote wound healing, or c) adjunct to chemotherapy to preventside effects such as alopecia, hypogonadism, muscle wasting,osteopenia, osteoporosis, sarcopenia, increased LDL, TG or totalcholesterol, decreased HDL. In another embodiment, the compositionsas described herein are useful in chronic catabolic states (coma,wasting conditions, starvation, eating disorders), concomitant bonefracture and muscle damage, critical illness in which muscle orbone wasting are apparent, and/or connective tissue diseases anddisorders.

Ischemic ulcers and pressure sores are wounds, which normally onlyheal very slowly and especially in such cases an improved and morerapid healing is of course of great importance for the patient.Furthermore, the costs involved in the treatment of patientssuffering from such wounds are markedly reduced when the healing isimproved and takes place more rapidly.

Donor site wounds are wounds which e.g. occur in connection withremoval of hard tissue from one part of the body to another part ofthe body e.g. in connection with transplantation. The woundsresulting from such operations are very painful and an improvedhealing is therefore most valuable.

The term "skin" is used in a very broad sense embracing theepidermal layer of the skin and in those cases where the skinsurface is more or less injured also the dermal layer of the skin.Apart from the stratum corneum, the epidermal layer of the skin isthe outer (epithelial) layer and the deeper connective tissue layerof the skin is called the dermis.

In some embodiments, the present invention provides a method forpromoting healing of anterior cruciate ligament (ACL) or medialcruciate ligament (MCL) injuries, or accelerating recovery afterACL or MCL surgery.

In some embodiments, burns are associated with reduced testosteronelevels, and hypogonadism is associated with delayed wound healing.In one embodiment, the methods of this invention, provide fortreating a subject suffering from a wound or a burn.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith an endocrine disorder in a subject. In some embodiments,endocrine disorders comprise acromegaly, Addison disease, adrenalgland diseases, adrenal hyperplasia, congenital,androgen-insensitivity syndrome, congenital hypothyroidism,Cushing's syndrome, diabetes insipidus, diabetes mellitus, diabetesmellitus-type 1, diabetes mellitus-type 2, diabetic, ketoacidosis,empty sella syndrome, endocrine gland neoplasms, endocrine systemdiseases, gigantism, gonadal disorders, graves disease,hermaphroditism, hyperaldosteronism, hyperglycemic hyperosmolarnonketotic coma, hyperpituitarism, hyperprolactinemia,hyperthyroidism, hypogonadism, hypopituitarism, hypothyroidism,Kallnmnn syndrome, Nelson syndrome, parathyroid diseases, pituitarydiseases, polyendocrinopathies, autoimmune, puberty, delayed,puberty, precocious, renal osteodystrophy, thyroid diseases,thyroid hormone resistance syndrome, thyroid neoplasms, thyroidnodule, thyroiditis, thyroiditis, autoimmune, thyroiditis,subacute, or Wolfram syndrome.

In one embodiment, "hypogonadism" is a condition resulting from orcharacterised by abnormally decreased functional activity of thegonads, with retardation of growth and sexual development.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith urogenital disease and/or fertility in a subject. In someembodiments, urogenital diseases and/or fertility diseases compriseabortion, spontaneous-adhesions-pelvic, candidiasis, vulvovagin*l,depression-postpartum, diabetes, gestational, dyspareunia,dystocia, eclampsia, endometriosis, fetal death, fetal growthretardation, fetal membranes, premature rupture, genital diseases,female, genital neoplasms, female, hydatidiform mole, hyperemesisgravidarum, infertility, ovarian cysts, ovarian torsion, pelvicinflammatory disease, placenta diseases, placental insufficiency,polycystic ovary syndrome, polyhydramnios, postpartum hemorrhage,pregnancy complications, pregnancy, ectopic, pruritus vulva,puerperal disorders, puerperal infection, salpingitis,trophoblastic neoplasms, uterine cervix incompetence, uterineinversion, uterine prolapse, vagin*l diseases, vulvar diseases, orvulvar lichen sclerosis.

In some embodiments the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith hemic and/or lymphatic disease in a subject. In someembodiments, hemic and/or lymphatic diseases compriseafibriogeneuia, anemia, aplastic anemia, hemolytic anemia,congenital nonspherocytic anemia, megaloblastic anemia, perniciousanemia, sickle cell anemia, angiolymphoid hyperplasia witheosinophilia, antithrombin III deficiency, Bernard-Souliersyndrome, blood coagulation disorders, blood platelet disorders,blue rubber bleb nevus syndrome, Chediak-Higashi syndrome,cryoglobulinemic, disseminated intravascular coagulation,eosinophilia, Erdheim-Chester disease, erythroblastosis, fetal,Evans syndrome, factor V deficiency, factor VII deficiency, factorX deficiency, factor XI deficiency, factor XII deficiency, fanconianemia, giant lymph node hyperplasia, hematologic diseases,hemoglobinopathies, hemoglobinuria, paroxysmal, hemophilia A,hemophilia B, hemorrhagic disease of newborn, histiocytosis,histiocytosis, Langerhans-cell, histiocytosis, non-Langerhans-cell,Job's syndrome, leukopenia, lymphadenitis,lymphangioleiomyomatosis, lymphedema, methemoglobinemia,myelodysplastic syndromes, myelofibrosis, myeloid metaplasia,myeloproliferative disorders, neutropenia, paraproteinemias,platelet storage pool deficiency, polycythemia vera, protein Cdeficiency, protein deficiency, purpura, thrombocytopenic, purpura,thrombotic thrombocytopenic, RH-isoimmunization, sarcoidosis,sarcoidosis, spherocytosis, splenic rupture, thalassemiathrombasthenia, thrombocytopenia, Waldenstrom macroglobulinemia, orVon Willebrand disease.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a congenital, hereditary, or neonatal disease in a subject. Insome embodiments, congenital, hereditary, and neonatal diseasescomprise Aicardi syndrome, amniotic band syndrome, anencephaly,Angelman syndrome, ataxia telangiectasia, Bannayan-Zonana syndrome,Barth syndrome, basal cell nevus syndrome, Beckwith-Wiedemannsyndrome, bloom syndrome, branchio-oto-renal syndrome, cat eyesyndrome, cerebral gigantism-charge syndrome, chromosome 16abnormalities, chromosome 18 abnormalities, chromosome 20abnormalities, chromosome 22 abnormalities, Costello syndrome,cri-du-chat syndrome, Currarino syndrome, cystic fibrosis, de-Langesyndrome, distal trisomy 10q, Down's syndrome, ectodermaldysplasia, fetal alcohol syndrome, fetal diseases, fetofetaltransfusion, fragile X syndrome, Freeman-Sheldon syndrome,gastroschisis, genetic diseases, inborn, hernia, umbilical,holoprosencephaly, incontinentia pigmenti, Ivemark syndrome,Jacobsen syndrome, jaundice, Klinefelter syndrome, Larsen syndrome,Laurence-moon syndrome, lissencephaly, microcephaly, monosomy 9p,nail-patella syndrome, neurofibromatoses, neuronalceroid-lipofuscinosis, Noonan syndrome, ochoa syndrome (urofacialsyndrome, hydronephrosis with peculiar facial expression),oculocereborenal syndrome, Pallister-Killian syndrome, Prader-Willisyndrome, proteus syndrome, prune belly syndrome, Rett syndrome,Robinow syndrome, Rubinstein-Taybi syndrome, schizencephaly, situsinversus, Smith-Lemli-Opitz syndrome, Smith-Magenis syndrome,Sturge-Weber syndrome, syphilis, congenital, trichothiodystrophy,triple-X females, trisomy 13 (Patau syndrome), trisomy 9, Turnersyndrome, twins, conjoined, Usher syndrome, Waardenburg's syndrome,Werner syndrome, or Wolf-Hirschhorn syndrome.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a connective tissue disease in a subject. In some embodiments,connective tissue diseases comprise ankylosing spondylitis,Ehlers-Danlos syndrome, Henoch-Schonlein purpura, Kawasaki disease,Marfan syndrome, polyarteritis nodosa, polymyositis, psoriaticarthritis, reactive arthritis, rheumatoid arthritis, scleroderma,Sjogren's syndrome, Still's disease, systemic lupus erythematosus,Takayasu disease, or Wegener's granulomatosis.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a metabolic disease in a subject. In some embodiments,metabolic diseases comprise acid-base imbalance, acidosis,alkalosis, alkaptonuria, alpha-mannosidosis, amino acid metabolisminborn errors, amyloidosis, iron-deficiency anemia, ascorbic aciddeficiency, avitaminosis, beriberi, biotinidase deficiency,carbohydrate-deficient glycoprotein syndrome, carnitine disorders,cystinosis, cystinuria, dehydration, Fabry disease, fatty acidoxidation disorders, fucosidosis, galactosemias. Gaudier disease,Gilbert disease, glucosephosphate dehydrogenase deficiency,glutaric acidemia, glycogen storage disease, Hartnup disease,hemochromatosis, hemosiderosis, hepatolenticular degeneration,histidinemia, hom*ocystinuria, hyperbilirubinemia, hypercalcemia,hyperinsulinism, hyperkalemia, hyperlipidemia, hyperoxaluria,hypervitaminosis A, hypocalcemia, hypoglycemia, hypokalemia,hyponatremia, hypophosphotasia, insulin resistance, iodinedeficiency, iron overload, jaundice, chronic idiopathic, Leighdisease, Lesch-Nyhan syndrome, leucine metabolism disorders,lysosomal storage diseases, magnesium deficiency, maple syrup urinedisease, Melas syndrome, Menkes kinky hair syndrome, metabolicdiseases, metabolic syndrome X, metabolism, inborn errors,mitochondrial diseases, mucolipidosis, mucopolysaccharidoses,Niemann-Pick diseases, obesity, ornithine carbamoyltransferasedeficiency disease, osteomalacia, pellagra, peroxisomal disorders,phenylketonurias, porphyria, erythropoietic, porphyrias, progeria,pseudo, gaucher disease, refsum disease, Reye syndrome, rickets,Sandhoff disease, starvation, tangier disease, Tay-Sachs disease,tetrahydrobiopterin deficiency, trimethylaminuria, tyrosinemiasurea cycle disorders, water-electrolyte imbalance, Wernickeencephalopathy, vitamin A deficiency, vitamin B12 deficiency,vitamin B deficiency, Wolman disease, or Zellweger syndrome.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a disorder of environmental origin in a subject. In someembodiments, disorders of environmental origin comprise barotrauma,bites and stings, brain concussion, burns, central cord syndrome,craniocerebral trauma, electric injuries, fractures, bone,frostbite, heat stress disorders, motion sickness, occupationaldiseases, poisoning, shaken baby syndrome, shoulder injuries, spacemotion sickness, spinal cord injuries, tick paralysis, or wounds(penetrating and non-penetrating).

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a behavior mechanism in a subject. In some embodiments,behavior mechanisms comprise aggression, attitude to death,codependency, self-injurious behavior, sexual behavior, or socialbehavior.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a mental disorder in a subject. In some embodiments, mentaldisorders comprise Asperger syndrome, attention deficit disorderwith hyperactivity, autistic disorder, bipolar disorder, borderlinepersonality disorder, capgras syndrome, child behavior disorders,combat disorders, cyclothymic disorder, dependent personalitydisorder, depressive disorder, dissociative disorders, dysthymicdisorder, eating disorders, firesetting behavior, hypochondriasis,impulse control disorders, Kleine-Levin syndrome, mental disorders,mental disorders diagnosed in childhood, multiple personalitydisorder, Munchhausen syndrome, narcissistic personality disorder,narcolepsy, obsessive-compulsive disorder, paraphilias, phobicdisorders, psychotic disorders, restless legs syndrome,schizophrenia, seasonal affective disorder, sexual and genderdisorders, sexual dysfunctions, psychological, sleep disorders,somatoform disorders, stress disorders, post-traumatic,substance-related disorders, suicidal behavior, ortrichotillomania.

In one embodiment, "depression" refers to an illness that involvesthe body, mood and thoughts that affect the way a person eats,sleeps and the way one feels about oneself and thinks about things.The signs and symptoms of depression include loss of interest inactivities, loss of appetite or overeating, loss of emotionalexpression, an empty mood, feelings of hopelessness, pessimism,guilt or helplessness, social withdrawal fatigue, sleepdisturbances, trouble concentrating, remembering, or makingdecisions, restlessness, irritability, headaches, digestivedisorders or chronic pain.

In one embodiment, "cognition" refers to the process of knowing,specifically the process of being aware, knowing, thinking,learning and judging. Cognition is related to the fields ofpsychology, linguistics computer science, neuroscience,mathematics, ethology and philosophy. In one embodiment, "mood"refers to a temper or state of the mind. As contemplated herein,alterations mean any change for the positive or negative, incognition and/or mood.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a liver disease in a subject. In some embodiments, liverdiseases comprise liver cancer, primary biliary cirrhosis,autoimmune hepatitis, chronic liver disease, cirrhosis of theliver, hepatitis, viral hepatitis (hepatitis A, hepatitis B,chronic hepatitis B, hepatitis C, chronic hepatitis C, hepatitis D,hepatitis B, hepatitis X), liver failure, jaundice, neonataljaundice, hepatoma, liver cancer, liver abscess, alcoholic liverdisease, hemochromatosis, Wilson's disease, portal hypertension,primary sclerosing cholangitis, sarcoidosis, tapeworms, alveolarhydatid disease, fascioliasis, schistosomiasis, Gaucher disease,Zellweger syndrome, alcoholism, food poisoning, pneumococcalpneumonia' or vibrio vulnifius.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a kidney disease in a subject. In some embodiments, kidneydiseases comprise acromegaly, acute renal failure (ARF)amyloidosis, autosomal dominant polycystic kidney disease, kidneystones, kidney cysts, autosomal recessive polycystic kidneydisease, chronic renal failure (CRF), chronic renal disease,chronic kidney disease (CKD), Coffin-Lowry syndrome, cor pulmonale,cryoglobulinemia, diabetic nephropathy, dyslipidemia, Gaucherdisease, glomerulonephritis, Goodpasture syndrome, hemolytic uremicsyndrome, hepatitis, kidney cancer, kidney stones, leukemia,lipoproteinemia, lupus, multiple myeloma, nephritis, polyarteritisnodosa, kidney cysts, post streptococcal glomerulonephritis,glomerulonephritis, kidney pain, preeclampsia, renal tuberculosis,pyelonephritis, renal tubular acidosis kidney disease,streptococcal toxic shock syndrome, thromboembolism, toxoplasmosis,urinary tract infections, uremia, vesicoureteral reflux, orWilliams syndrome. In some embodiments, the kidney disease beingtreatment comprises kidney metabolic syndrome.

In one embodiment the kidney disease or disorder is acute, or inanother embodiment, chronic. In one embodiment clinical indicationsof a kidney disease or disorder, wherein the methods of treatmentmay be useful include urinary casts, measured GFR, or other markersof renal function.

In one embodiment, the kidney disease or disorder is a chronickidney disease (CKD). In some embodiments treating CKD patientsincludes treating those with advanced disease (uremia), and maycomprise treating muscle wasting, repetitive catabolic stimuli(chronic infections, dialysis), anorexia, or other associatedconditions, which will comprise what is meant by treating thedisease.

In one embodiment, the SARM compounds of this invention are usefulin increasing muscle and physical performance in a subject, in someembodiments, improving the patients' quality of life, diminishingmorbidity and/or mortality, improving insulin resistance, and otherassociated conditions, thereby treating the subject afflicted witha disorder as described herein. In same embodiments, use of thecompounds/compositions of this invention treats or improves afunctional impairment in the subject, including, inter alia, onethat results in a decrease in physical performance, inability toperform daily activity, decrease in muscle strength, decrease inexercise capacity, increase in frailty and/or decrease in qualityof life.

In one embodiment CKD predisposes the subject to functionalimpairment, which in turn may result in the presence of a chronicinflammatory state, local and systemic inflammatory effects,increased adiposity (e.g. visceral adipose tissue), decreased LBMand/or any adverse effects of adipose tissue. In some embodiments,conventional therapies such as the administration of anabolichormones lose efficacy in such subjects, as a result of resistanceto the anabolic hormones resulting in decreased levels andresistance to actions (for example due to uremic toxins), however,the compounds/compositions of this invention may in someembodiments be effective in such a scenario.

In one embodiment, S-(III) of this invention and compositionscomprising the same is useful in improving Stage 3 and 4 CKD, by,inter alia, and in some embodiments, increasing lean body mass(LBM), improving physical performance, increasing quality of life,decreasing adiposity, improving physical performance, decreasingmuscle catabolism, improving or treating renal metabolic syndrome,decreasing risk for development of insulin resistance and/ordecreasing the risk for heart disease.

In one embodiment, the SARM compounds of this invention improvemuscle wasting and physical performance in end-stage renal disease(dialysis) patients or patients with chronic kidney disease. Insome embodiments, the treatment methods of this invention areuseful in treating uremic cachexia and/or complications, diseasesand/or conditions associated thereto.

In some embodiments, administration of the SARM compound for theabove indications is at a dose of 1 or 3 mg daily.

In one embodiment, the methods of this invention are useful insubjects predisposed to kidney diseases or disorders. In oneembodiment, the phrase "predisposed to a kidney disease ordisorder" with respect to a subject is synonymous with the phrase"subject at risk", and includes a subject at risk of acute orchronic renal failure, or at risk of the need for renal replacementtherapy, if the subject is reasonably expected to suffer aprogressive loss of renal function associated with progressive lossof functioning nephron units. Whether a particular subject is atrisk is a determination which may routinely be made by one ofordinary skill in the relevant medical or veterinary art.

In one embodiment, subjects with kidney disease, in particular malesubjects with end-stage renal disease (ESRD) suffer fromhypogonadism, with some having concomitant moderate to severeprotein-energy malnutrition (PEM), which leads to higher requireddoses of EPO, lower QoL scores, and higher mortality. Many haveother symptoms associated with hypogonadism, including fatigue,lack of appetite, muscle weakness, etc. In some embodiments, thetreatment methods of this invention are useful in treating symptomassociated with hypogonadism, brought about in the subject by thekidney disease or disorder. In another embodiment, brought about inthe subject by androgen deficiency in a female (ADIF); androgendeficiency in aging male (ADAM) to include fatigue, depression,decreased libido, erectile dysfunction, decreased cognition,decreased mood; androgen insufficiency (male or female), orandrogen deficiency (male or female).

Hypertension is another comorbid factor for renal disease. In someembodiments, treatment of renal disease according to the presentinvention may comprise concomitant treatment with a SARM and anagent which treats hypertension.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a wasting disease in a subject. In some embodiments, wastingdiseases comprise muscle injury, bed rest, immobility, nerveinjury, neuropathy, diabetic neuropathy, alcoholic neuropathy,anorexia, anorexia nervosa, anorexia associated with cachexia,anorexia associated with aging, subacute combined degeneration ofthe spinal cord, diabetes, rheumatoid arthritis, motor neuronediseases, duch*enne muscular dystrophy, carpal tunnel syndrome,chronic infection, tuberculosis, Addison's disease, adult SMA, limbmuscle atrophy, back tumour, dermatomyositis, hip cancer, inclusionbody myositis, incontinentia pigmenti, intercostal neuralgia,juvenile rheumatoid arthritis, Legg-Calve-Perthes disease, muscleatrophy, multifocal motor neuropathy, nephrotic syndrome,osteogenesis imperfecta, post-polio syndrome, rib tumor, spinalmuscular atrophy, reflex sympathetic dystrophy syndrome, orTay-Sachs.

In some embodiments, the present invention provides a method forprevention of statin induced rhabdomyolysis. In some embodiments,the present invention provides a method for prevention of statininduced rhabdomyolysis, organ failure or insufficiency. In someembodiments, the present invention provides a method for preventionof statin induced kidney or liver failure or insufficiency. In oneembodiment, the method comprises administering to a subject acomposition comprising a SARM compound and a statin.

In one embodiment, the wasting disease is cachexia or involuntaryweight loss in a subject. In another embodiment, the presentinvention provides a method of treating, preventing, inhibiting,reducing or suppressing muscle wasting in a subject suffering froma kidney disease. In one embodiment, the present invention providesa method of treating, preventing, inhibiting, reducing orsuppressing protein catabolism in a subject suffering from a kidneydisease or disorder,

Cachexia is weakness and a loss of weight caused by a disease or asa side effect of illness. Long term hospitalization due to illnessor injury, or disuse deconditioning that occurs, for example, whena limb is immobilized, can also lead to muscle wasting. Studieshave shown that in patients suffering injuries, chronic illnesses,burns, trauma or cancer, who are hospitalized for long periods oftime, there is a long-lasting unilateral muscle wasting, with aconsequent decrease in body mass. Nervous system injury, forexample, spinal cord injury, as described further herein, may be acontributory factor, as well.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a wasting diseases or disorders in a subject. In anotherembodiment, the wasting diseases and disorders include inter-alia:a) acquired immunodeficiency syndrome (AIDS) wasting; b) wastingassociated with bed rest; c) bulimia, and/or wasting associatedwith bulimia; d) cachexia; e) cancer cachexia; f) HIV wasting; org) reduce cachexia and protein loss due to prolonged criticalillness, pulmonary dysfunction, ventilator dependency, aging, AIDS,trauma, surgery, congestive heart failure, cardiac myopathy, burns,cancer, chronic obstructive pulmonary disease (COPD), eatingdisorders such as bulimia, anorexia nervosa, loss of appetite,starvation, and/or depression.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith invalid or debilitated states in a subject.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a hypogonadal state in a subject. In one embodiment, thepresent invention provides a method for treating, reducing theincidence, delaying the onset or progression, or reducing and/orabrogating the symptoms associated with a pharmacotherapy inducedhypogonadal state in a subject. In some embodiments, hypogonadismis caused by treatments which alter the secretion of hormones fromthe sex glands in both women and men. In some embodiments,hypogonadism may be "primary" or "central." In primaryhypogonadism, the ovaries or testes themselves do not functionproperly. In some embodiments, hypogonadism may be induced bysurgery, radiation, genetic and developmental disorders, liver andkidney disease, infection, or certain autoimmune disorders. In someembodiments, menopause is a form of hypogonadism. Menopause maycause, in some embodiments, amenorrhea, hot flashes, vagin*ldryness, or irritability due to woman's estrogen levels fall.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith osteopenic state in a subject. In one embodiment, the presentinvention provides a method for treating, reducing the incidence,delaying the onset or progression, or reducing and/or abrogatingthe symptoms associated with a pharmacotherapy induced osteopenicstate in a subject. In some embodiments, osteopenia is a mildthinning of the bone mass. In some embodiments, osteopenia is aprecursor to osteoporosis. In some embodiments osteopenia isdefined as a bone density between one standard deviation (SD) and2.5 SD below the bone density of a normal young adult.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a sarcopenic state in a subject. In one embodiment, thepresent invention provides a method for treating, reducing theincidence, delaying the onset or progression, or reducing and/orabrogating the symptoms associated with a pharmacotherapy inducedsarcopenic state in a subject. In some embodiments, sarcopenia is asignificant loss of muscle mass. In one embodiment, sarcopeniadefinition is having a lean body mass less than two standarddeviation below the mean for normal young adults. In someembodiments, sarcopenia is caused by genetic factors, alteredcirculation, decrease in the capillary:muscle fiber ratio, alteredmotor neurons, denervation, deterioration of motor end plates,selective reinnervation of type I fibers, inflammatory responsescausing muscle damage, reduced exercise, malnutrition, low dietaryprotein intake, vitamin D deficiency, age-related decline invitamin D, oxidative stress, muscle mitochondrial mutations,changes in specific types of muscle fibers, decline in muscleprotein, disabling disease, strokes, Alzheimer's disease,Parkinson's disease, osteoporosis, atherosclerosis, diabetesmellitus, hyperinsulinemia, renal failure, or hypogonadism.

In some embodiments, the present invention provides a method fortreating, reducing the incidence, delaying the onset orprogression, or reducing and/or abrogating the symptoms associatedwith a combination of diseases and/or disorders in a subject asdescribed hereinabove. It is to be understood that any method ofthis invention, as herein described, encompasses the administrationof a SARM compound as herein described, or a composition comprisingthe same, to the subject, in order to treat the indicated disease,disorder or condition. The methods as herein described each and/orall may further comprise administration of an additionaltherapeutic agent as herein described, and as will be appreciatedby one skilled in the art.

In some embodiments, the present invention provides a method forenhanced production such as milk, sperm, or egg. In someembodiments, the present invention provides a method for enhancedproduction of lean meats or eggs. In some embodiments, the presentinvention provides a method for increased productivity of feeds orstud livestock, for example, increased sperm count, improvedmorphology of sperm, etc. In some embodiments, the presentinvention provides a method for expanding the productive life offarm animals, for example, egg-laying hens, milk-producing cows,etc, and/or enhanced herd health, for example, improved immuneclearance, stronger animals.

In one embodiment, the method comprises administering to a subjecta composition comprising a SARM compound and an anti-cancer agent,an immunomodulating agent, an antidiabetic agent, an agent treatingthe cardiovascular system, an agent treating the gastrointestinalsystem, an agent treating the central nervous system, an agenttreating a metabolic disease, an agent treating a wasting disease,a gene therapy agent, an agent treating the endocrine system, anagent treating a dermatological disorder, an anti-infective agent,an agent treating the liver, an agent treating the kidney,vitamins, nutritional additives, hormones, each and/or all asherein described, or any other therapeutic agent as hereindescribed, or a combination thereof. In another embodiment, theanti-cancer agent is a chemotherapeutic agent as describedhereinabove. In another embodiment, the chemotherapeutic agentcomprises: bendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab chlorambucil, cisplatin,cyclophosphamide, cytarabine, dasatinib, docetaxel, doxorubicin,erlotinib, etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib, methotrexate,methylprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof.

In another embodiment, this invention provides methods of treatmentof cystic fibrosis and induced hypogonadal states as a result ofthe same, epilepsy and induced hypogonadal and/or hypermetabolicstates as a result of the same, hereditary angioedema, lupuserythematosus and decreased bone mineral density as a result of thesame, alcohol and smoking induced osteoporosis, in a subject themethods comprising administering a SARM as herein described to thesubject.

In another embodiment, this invention provides methods of treatmentof polio and post-polio syndrome and other invalid states, statininduced rhabdomyolysis, statin-induced muscle weakness,statin-induced organ failure or insufficiency, in a subject, themethods comprising the administration of a SARM as hereindescribed, optionally with a statin, as appropriate, as will beappreciated by one skilled in the art, and/or with any therapeuticagent.

In another embodiment, this invention provides a method of treatingopioid induced androgen deficiency (OPIAD), the method comprisingadministering to the subject a SARM as herein described, andoptionally opiates, opioids, narcotics, etc. methadone, long-actingopiates/opioids such as Kadian.RTM., extended release morphines,all opiates/opioids/narcotics agents approved by FDA,opiates/opioids used in treatment of heroin addiction,opiates/opioids used in the treatment of chronic pain ofmalignancy, opiates/opioids used in the treatment non-malignant ofchronic pain syndromes.

In another embodiment, this invention provides a method of treatinga nervous system disease, disorder or condition, the methodcomprising administering to the subject a SARM as herein described,and optionally anti-psychotics, such as, for example, zotepine,haloperidol, amisulpride, risperidone, other D.sub.2 dopaminereceptor antagonists; anti-epileptics, such as valproic acid,carbamazepine, oxcarbamazepine, etc. or combinations thereof.

In another embodiment, this invention provides a method of treatinga hormone dependent disease, disorder or condition, the methodcomprising administering to the subject a SARM as herein described,and optionally chemotherapeutics agents and anti-cancer therapies(methotrexate, cyclophosphamide, ifosfamide, adriamycin,doxorubicin, glucocorticoids, cyclosporine, L-thyroxine, SERMs,aromatase inhibitors, fulvestrant, GnRH agents, ADT,discontinuation of hormone replacement therapy, cranialirradiation, peripheral irradiation, etc.; prolactinemia-inducingpharmcotherapeutics (serotonergic antidepressants acting through5HT.sub.2 receptors, selective serotonin reuptake inhibitors,monoamine oxidase inhibitors, tricyclic antidepressants,antihypertensives such as methyldopa, reserpine, clonidine, andverapamil; antidopaminergic anti-emetics such as metoclopramide,H.sub.2 receptor antagonists such as cimetidine and ranitidine,estrogens, amphetamines, AR partial antagonists (ketoconazole,spironolactone, eplerenone).

In another embodiment, the SARMs and compositions as describedherein are useful in promoting or speeding recovery following asurgical procedure.

In one embodiment, the present invention provides a use of a SARMcompound as described herein for reducing a fat mass in a subject.In another embodiment the invention provides such methods for useof the SARM compound as described herein or its prodrug, analog,isomer, metabolite, derivative, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, N-oxide,hydrate or any combination thereof, or a composition comprising thesame.

In another embodiment, this invention provides for the use of theSARM compounds as described herein or its analog, derivative,isomer, metabolite, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, hydrate,N-oxide or any combination thereof, for treating abdominal fataccumulation improving body composition; lowering body fat content;lowering fat mass; improving blood lipid profile, increasing musclemass/strength/function; increasing bone mass/bone mineraldensity/strength/function; lowering body fat; congenitalhyperinsulinemia; Cushing's disease (hypercortisolemia); or obesityor diabetes associated with a metabolic syndrome in a subject.

In another embodiment, the subject has a hormonal imbalance,disorder, or disease. In another embodiment the subject hasmenopause.

In one embodiment, the present invention provides a use of a SARMcompound as described herein for increasing a lean mass in asubject. In another embodiment such use comprises administration ofa SARM compound as described herein or its prodrug, analog, isomer,metabolite, derivative, pharmaceutically acceptable salt,pharmaceutical product, polymorph, crystal, impurity, N-oxide,hydrate or any combination thereof.

Example 2 demonstrates that a compound of formula S-(III) isanabolic yet minimally androgenic, this such compounds may beuseful in treating patient groups in which androgens werecontraindicated in the past. Compound of formula S-(III) was shownto stimulate muscle growth, whether in the presence or absence oftestosterone while exerting anti-proliferative effects on theprostate, thus, in one embodiment, the methods of this inventionprovide for restring lost muscle mess in patients with sarcopeniaor cachexia.

In one embodiment, the SARM compounds as herein described alter thelevels of leptin in a subject. In another embodiment, the SARMcompounds as herein described decrease the levels of leptin. Inanother embodiment, the SARM compounds as herein described increasethe levels of leptin in a subject. Leptin is known to have aneffect on appetite on weight loss in obese nice, and thus has beenimplicated in obesity.

The SARM compounds as herein described, in one embodiment, affectcirculating, or in another embodiment, tissue levels of leptin. Inone embodiment, the term `level/s of leptin` refers to the serumlevel of leptin. As contemplated herein, the SARM compounds of thepresent invention have an effect on leptin in vitro and in vivo.Leptin levels can be measured by methods known to one skilled inthe art, for example by commercially available ELISA kits. Inaddition, leptin levels may be determined in in vitro assays, or inin vivo assays, by any method known to a person skilled in theart.

Since leptin is implicated in controlling appetite, weight loss,food intake, and energy expenditure, modulating and/or controllingthe levels of leptin is a useful therapeutic approach in treating,preventing, inhibiting or reducing the incidence of obesity insubjects suffering from obesity. Modulating the level of leptin canresult in a loss of appetite, a reduction of food intake, and anincrease in energy expenditure in the subject, and thus maycontribute to the control and treatment of obesity.

The term "obesity" is defined, in one embodiment, as an increase inbody weight beyond the limitation of skeletal and physicalrequirement, as the result of excessive accumulation of fat in thebody.

The term "obesity-associated metabolic disorder" refers, in oneembodiment, to a disorder which results from, is a consequence of,is exacerbated by or is secondary to obesity. Non-limiting examplesof such a disorder are osteoarthritis, type II diabetes mellitus,increased blood pressure, stroke, and heart disease.

Cholesterol, triacylglycerol and other lipids are transported inbody fluids by lipoproteins which may be classified according totheir density, for example, the very low density lipoproteins(VLDL), intermediate density lipoproteins (IDL), low densitylipoproteins (LDL) and high density lipoproteins (HDL).

It has been shown that high levels of LDL-cholesterol in the bloodcorrelate with atherosclerosis which is a progressive diseasecharacterized in pert by sedimentation of lipids in inner walls ofarteries, particularly of coronary arteries. It has also been shownthat a high blood level of LDL-cholesterol correlates with coronaryheart disease. Also, a negative correlation exists between bloodlevels of HDL cholesterol and coronary heart disease.

The level of total cholesterol in blood, which is the sum ofHDL-cholesterol, LDL-cholesterol, VLDL-cholesterol andchylomicron-cholesterol, is not necessarily predictive of the riskof coronary heart disease and atherosclerosis.

The correlation between atherosclerosis and LDL cholesterol levels,however, is much higher than a similar correlation betweenatherosclerosis and total serum cholesterol levels.

In one embodiment, this invention provides methods of use of theSARM compounds as herein described for improving the lipid profileand/or reducing the circulating lipid levels in a subject. In someembodiments, according to this aspect of the invention, the subjectsuffers from one or more conditions comprising atherosclerosis andits associated diseases, premature aging, Alzheimer's disease,stroke, toxic hepatitis, viral hepatitis, peripheral vascularinsufficiency, renal disease, and/or hyperglycemia, and theinvention provides for the administration of a SARM compound orcomposition comprising the same, as herein described, which in someembodiments positively affects a lipid profile in the subject,which is one means by which the method is useful in treating theindicated diseases, disorders and conditions.

In one embodiment the invention provides for the treatment ofatherosclerosis and its associated diseases, such as for example,cardiovascular disorders, cerebrovascular disorders, peripheralvascular disorders, intestinal vascular disorders, or combinationsthereof.

In one embodiment, cardiovascular disorders comprise hypertension(HTN), coronary artery disease (CAD) or myocardial perfusion. Inanother embodiment this invention provides methods of use of thecompositions as herein described for promoting aortic smooth musclecell proliferation. In another embodiment this invention providesmethods of use of the compositions as herein described for treatingarteriosclerosis. In another embodiment this invention providesmethods of use of the compositions as herein described for loweringblood pressure. In another embodiment this invention providesmethods of use of the compositions as herein described for treatingcardiac diseases and disorders comprising cardiomyopathy, cardiacdysfunctions such as, myocardial infarction, cardiac hypertrophyand congestive heart failure. In another embodiment this inventionprovides methods of use of the compositions as herein described forcardioprotection comprising cardioprotection in insulin resistance;treating diabetes type I and II, metabolic syndrome, syndrome Xand/or high blood pressure.

In one embodiment, the invention provides a method of treating,preventing, reducing the risk of mortality from cardiovascularand/or cerebrovascular disease in a subject, comprisingadministering a compound of formula (I-XX or S-(III)) or itsprodrug, ester, analog, isomer, metabolite, derivative,pharmaceutically acceptable salt, pharmaceutical product,polymorph, crystal, impurity, N-oxide, hydrate or any combinationthereof, or a pharmaceutical composition comprising the same. Inone embodiment, the SARM compound is characterized by the structureof formula S-(III).

In one embodiment, compounds of formulae I-XX reduce LDL and totalcholesterol levels, and in one embodiment the SARM compound offormula S-(III) reduces LDL and total cholesterol levels in asubject.

In another embodiment, compounds of formulae I-XX areco-administered with HDL-elevating agents. In another embodiment, acompound of formula S-(III) is co-administered with HDL-elevatingagents. In another embodiment, HDL-elevating agents include niacin.In another embodiment the HDL-elevating agents include fibratesincluding gemfibrozil (Lopid.RTM.), thiourea based gemfibrozilanalogues, and fenofibrate (TriCor.RTM.). In another embodiment,HDL-elevating agents include statins. In another embodiment,HDL-elevating agents include cholesteryl ester transferase protein(CETP) inhibitors including anacetripib. In another embodiment,HDL-elevating agents include 1-hydroxyalkyl-3-phenylthiourea, andanalogs thereof.

In one embodiment, this invention provides a method of reducingcirculating lipid levels in a subject, said method comprisingadministering a selective androgen receptor modulator (SARM)compound of formula I-XX or S-(III) or its pharmaceuticallyacceptable salt, hydrate, N-oxide, or any combination thereof, or acomposition comprising the same. In one embodiment, the subjectsuffers from atherosclerosis and its associated diseases, prematureaging. Alzheimer's disease, stroke, toxic hepatitis, viralhepatitis, peripheral vascular insufficiency, renal disease,hyperglycemia, or any combination thereof.

In one embodiment, this invention provides a method of treatingatherosclerosis and its associated diseases, such as, for example,cardiovascular disorders, cerebrovascular disorders, peripheralvascular disorders, or intestinal vascular disorders in a subject,the method comprising the step of administering to the subject aselective androgen receptor modulator (SARM) compound of formulaI-XX or S-(III) or its pharmaceutically acceptable salt, hydrate,N-oxide, or any combination thereof, or a composition comprisingthe same. The method may further comprise co-administration,subsequent or prior administration with an agent or agents, whichare known to be useful in treating cardiovascular disorders,cerebrovascular disorders, peripheral vascular disorders, orintestinal vascular disorders.

In one embodiment, this invention provides a method of improvingthe dexterity and movement in a subject, for example, by treatingarthritis in the subject.

The term "arthritis" refers, in another embodiment, to anon-inflammatory degenerative joint disease occurring chiefly inolder people, characterized by degeneration of the articularcartilage, hypertrophy of bones and the margins, changes in thesynovial membrane, etc. It is accompanied, in other embodiments, bypain and stiffness, particularly after prolonged activity.

The term "diabetes", in one embodiment, refers to a relative orabsolute lack of insulin leading to uncontrolled carbohydratemetabolism. Most patients can be clinically classified as havingeither insulin-dependent diabetes mellitus (IDDM or type-Idiabetes) or non-insulin-dependent diabetes mellitus (NIDDM ortype-II diabetes).

The term "increased blood pressure" or "hypertension" refers, inother embodiments, to a repeatedly high blood pressure above 140over 90 mmHg. Chronically-elevated blood pressure can cause bloodvessel changes in the back of the eye, thickening of the heartmuscle, kidney failure, and brain damage.

The term "stroke" refers, in other embodiments, to damage to nervecells in the brain due to insufficient blood supply often caused bya bursting blood vessel or a blood clot. The term "heart disease",in other embodiments, refers to a malfunction in the heart normalfunction and activity, including heart failure.

In addition, androgens have recently been shown to be involved incommitment of mesenchymal pluripotent cells into myogenic lineageand to block differentiation into adipogenic lineage (Singh et al.,Endocrinology, 2003 Jul. 24). Accordingly, SARM compounds can beuseful in methods of blocking adipogenesis, and/or alerting stemcell differentiation, as described herein.

In another embodiment, this invention relates to a method ofpromoting, increasing or facilitating weight loss in a subject,comprising the step of administering to the subject a SARM asherein described and/or its analog, derivative, isomer, metabolite,pharmaceutically acceptable salt, pharmaceutical product, hydrate,N-oxide, prodrug, polymorph, crystal, or any combination thereof,in an amount effective to promote, increase or facilitate weighloss in the subject.

In another embodiment, this invention relates to a method ofdecreasing, suppressing, inhibiting or reducing appetite of asubject, comprising the step of administering to the subject a SARMas herein described and/or its analog, derivative, isomer,metabolite, pharmaceutically acceptable salt, pharmaceuticalproduct, hydrate, N-oxide, prodrug, polymorph, crystal, or anycombination thereof, in an amount effective to decrease, suppress,inhibit or reduce the appetite of the subject.

In another embodiment, this invention relates to a method ofaltering the body composition of a subject, comprising the step ofadministering to the subject a SARM as herein described and/or itsanalog, derivative, isomer, metabolite, pharmaceutically acceptablesalt, pharmaceutical product, hydrate, N-oxide, prodrug, polymorph,crystal, or any combination thereof, in an amount effective toalter the body composition of the subject. In one embodiment,altering the body composition comprises altering the lean bodymass, the fat free body mass of the subject, or a combinationthereof.

In another embodiment, this invention relates to a method ofaltering lean body mass or fat free body mass of a subject,comprising the step of administering to the subject a SARM asherein described and/or its analog, derivative, isomer, metabolite,pharmaceutically acceptable salt, pharmaceutical product, hydrate,N-oxide, prodrug, polymorph, crystal, or any combination thereof,in an amount effective to alter the lean body mass or fat free bodymass of the subject.

In another embodiment, this invention relates to a method ofconverting fat to lean muscle in a subject, comprising the step ofadministering to the subject a SARM as herein described and/or itsanalog, derivative, isomer, metabolite, pharmaceutically acceptablesalt, pharmaceutical product, hydrate, N-oxide, prodrug, polymorph,crystal, or any combination thereof, in an amount effective toconvert fat to lean muscle in the subject. In another embodiment,this invention relates to a method of converting fat to lean musclein a subject suffering from a wasting disorder. In anotherembodiment, this invention relates to a method of converting fat tolean muscle in a subject suffering from a wasting disorder whereinthe wasting disorder is a muscular dystrophy. In anotherembodiment, this invention relates to a method of converting fat tolean muscle in a subject suffering from a wasting disorder whereinthe wasting disorder is duch*enne muscular dystrophy.

In another embodiment, this invention relates to a method oftreating an obesity-associated metabolic disorder in a subject,comprising the step of administering to the subject a SARM asherein described and/or its analog, derivative, isomer, metabolite,pharmaceutically acceptable salt, pharmaceutical product, hydrate,N-oxide, prodrug, polymorph, crystal, or any combination thereof,in an amount effective to treat the obesity-associated metabolicdisorder in the subject.

In another embodiment, this invention relates to a method ofpreventing, suppressing, inhibiting or reducing anobesity-associated metabolic disorder in a subject, comprising thestep of administering to the subject a SARM as herein describedand/or its analog, derivative, isomer, metabolite, pharmaceuticallyacceptable salt, pharmaceutical product, hydrate, N-oxide, prodrug,polymorph, crystal, or any combination thereof, in an amounteffective to prevent, suppress, inhibit or reduce theobesity-associated metabolic disorder in the subject.

In one embodiment, the obesity-associated metabolic disorder ishypertension. In another embodiment, the disorder isosteoarthritis. In another embodiment, the disorder is type IIdiabetes mellitus. In another embodiment, the disorder is increasedblood pressure. In another embodiment, the disorder is stroke. Inanother embodiment, the disorder is heart disease.

In another embodiment, this invention relates to a method ofdecreasing, suppressing, inhibiting or reducing adipogenesis in asubject, comprising the step of administering to the subject a SARMas herein described and/or its analog, derivative, isomer,metabolite, pharmaceutically acceptable salt, pharmaceuticalproduct, hydrate, N-oxide, prodrug, polymorph, crystal, or anycombination thereof.

In another embodiment, this invention relates to a method ofaltering stem cell differentiation in a subject, comprising thestep of administering to the subject a SARM as herein describedand/or its analog, derivative, isomer, metabolite, pharmaceuticallyacceptable salt, pharmaceutical product, hydrate, N-oxide, prodrug,polymorph, crystal, or any combination thereof, in an amounteffective to alter stem cell differentiation in the subject.

In one embodiment, the SARM that's as herein described are usefulin: a) treating, preventing, suppressing, inhibiting, or reducingobesity; b) promoting, increasing or facilitating weight loss; c)decreasing, suppressing, inhibiting or reducing appetite; d)altering the body composition; e) altering lean body mass or fatfree body mass; f) converting fat to lean muscle; g) treating,preventing, suppressing, inhibiting, or reducing anobesity-associated metabolic disorder, for example hypertension,osteoarthritis, diabetes mellitus, maturity onset diabetes of theyoung (MODY), increased blood pressure, stroke, or heart disease;h) decreasing, suppressing, inhibiting or reducing adipogenesis; i)altering stem cell differentiation; and/or j) altering the level ofleptin.

In one embodiment, the SARMs as herein described find utility intreating or halting the progression of or treating symptoms ofdiabetes. In another embodiment, the SARMs as herein described areuseful in treating co-morbidities related to diabetes. Theseconditions include: hypertension, cerebrovascular disease,atherosclerotic coronary artery disease, macular degeneration,diabetic retinopathy (eye disease) and blindness,cataracts-systemic inflammation (characterized by elevation ofinflammatory markers such as erythrocyte sedimentation rate orC-reactive protein), birth defects, pregnancy related diabetes,pre-eclampsia and hypertension in pregnancy, kidney disease (renalinsufficiency, renal failure etc.), nerve disease (diabeticneuropathy), superficial and systemic fungal infections, congestiveheart failure, gout/hyperuricemia, obesity, hypertriglyceridemia,hypercholesterolemia, fatty liver disease (non-alcoholicsteatohepatitis, or NASH), and diabetes-related skin diseases suchas necrobiosis lipoidica diabeticorum (NLD), blisters of diabetes(bullosis diabeticorum), eruptive xanthomatosis, digital sclerosis,disseminated granuloma annulare, and acanthosis nigricans.

In one embodiment this invention provides a method of treating,suppressing, inhibiting or reducing the incidence of (a) diabetestype I; (b) diabetes type II; (c) glucose intolerance; (d)hyperinsulinemia; (e) insulin resistance; (f) nephropathy; (g)diabetic neuropathy; (h) diabetic retinopathy; (i) fatty liverconditions; (j) MODY; and (k) cardiovascular disease in a humansubject, comprising the step of administering to said subject aselective androgen receptor modulator compound of formula I-XX orS-(III).

In some embodiments, the SARMs as herein described and/orcompositions comprising the same may be used for applications in,or treating diseases or conditions associated with a subject havingdiabetes. In one embodiment, the subject for whom treatment issought via the methods of this invention is one with diabetic I.Type I diabetes is characterized by autoimmune destruction ofpancreatic beta-cells. Markers of immune destruction of thebeta-cell are present at the time of diagnosis in 90% ofindividuals and include antibodies to the islet cell (ICAs), toglutamic acid decarboxylase (GAD), and to insulin (IAAs). Whilethis form of diabetes usually occurs in children and adolescents,it can occur at any age. Younger individuals typically have a rapidrate of beta-cell destruction and present with ketoacidosis, whileadults often maintain sufficient insulin secretion to preventketoacidosis for many years. Eventually, all type I diabeticpatients require insulin therapy to maintain normglycemia.

In one embodiment, this invention provides a method of treatingdiabetes type II. Type II diabetes is characterized by insulinresistance and at some stage in pathogenesis of the disease, arelative deficiency of insulin secretion. In absolute terms, theplasma insulin concentration (both fasting and meal-stimulated)usually is increased, although "relative" to the severity ofinsulin resistance, the plasma insulin concentration isinsufficient to maintain normal glucose homeostasis. With time,however, there is progressive beta cell failure and absoluteinsulin deficiency ensues. Most individuals with type II diabetesexhibit intra abdominal (visceral) obesity, fatty liver, which isclosely related to the presence of insulin resistance. Thepatient's liver becomes insulin resistant and glycogen breakdown isuncontrolled and the result is increased and unphysiologicalglucose delivery to the bloodstream. The liver generation ofcholesterol and VLDL particles is also uncontrolled. In addition,hypertension, dyslipidemia (high triglyceride and lowHDL-cholesterol levels; postprandial hyperlipemia), and elevatedPAI-1 levels often are present in these individuals. Thisclustering of abnormalities is referred to as the "insulinresistance syndrome", or the "metabolic syndrome" or obesityrelated disorders. Because of these abnormalities, patients withtype U diabetes are at increased risk of developing macrovascularcomplications such as myocardial infarction and stroke.

In one embodiment, this invention provides a method of treatingdiabetic nephropathy. Diabetic nephropathy is a complication ofdiabetes that evolves early, typically before clinical diagnosis ofdiabetes is made. The earliest clinical evidence of nephropathy isthe appearance of low but abnormal levels (>30 mg/day or 20.mu.g/min) of albumin in the urine (microalbuminuria), followed byalbuminuria (>300 mg/24 h or 200 .mu.g/min) that develops over aperiod of 10-15 years. In patients with type 1 diabetes, diabetichypertension typically becomes manifest early on, by the time thatpatients develop microalbuminuria. Once overt nephropathy occurs,the glomerular filtration rate (GFR) falls over a course of times,which may be several years, resulting in end stage renal disease(ESRD) in diabetic individuals.

In one embodiment, this invention provides a method of treatingdiabetic neuropathy. Diabetic neuropathy is a family of nervedisorders caused by diabetes. Diabetic neuropathies cause numbnessand sometimes pain and weakness in the hands, arms, feet, and legs.Neurologic problems in diabetes may occur in every organ system,including the digestive tract, heart, and genitalia. Diabeticneuropathies are classified as peripheral, autonomic, proximal, andfocal. Peripheral neuropathy causes pain or loss of feeling in thetoes, feet, legs, bands, and arms. Autonomic neuropathy causeschanges in digestion, bowel and bladder function, sexual response,and perspiration and can also affect the nerves that serve theheart and control blood pressure. Proximal neuropathy causes painin the thighs, hips, or buttocks and leads to weakness in the legs.Focal neuropathy results in the sudden weakness of one nerve, or agroup of nerves, causing muscle weakness or pain. Any nerve in thebody may be affected.

In one embodiment, this invention provides a method of treatingdiabetic retinopathy. The effect of diabetes on the eye is calleddiabetic retinopathy. Patients with diabetes are more likely todevelop eye problems such as cataracts and glaucoma. The affect ofdiabetic retinopathy on vision varies widely, depending on thestage of the disease. Some common symptoms of diabetic retinopathyare blurred vision (this is often linked to blood sugar levels),floaters and flashes and sudden loss of vision.

In one embodiment, the subject for whom treatment is sought via themethods of this invention is one with glucose intolerance. Glucoseintolerance is a pre-diabetic state in which the blood glucose ishigher than normal but not high enough to warrant the diagnosis ofdiabetes.

In one embodiment, the subject for whom treatment is sought via themethods of this invention is one with hyperinsulinemia.Hyperinsulinemia is a sign of an underlying problem that is causingthe pancreas to secrete excessive amounts of insulin. The mostcommon cause of hyperinsulinemia is insulin resistance, a conditionin which your body is resistant to the effects of insulin and thepancreas tries to compensate by making more insulin,hyperinsulinemia is associated with type II diabetes

In one embodiment, the subject for whom treatment is sought via themethods of this invention is one with insulin resistance. Insulinresistance is a condition in which normal amounts of insulin areinadequate to produce a normal insulin response from fat, muscleand liver cells. Insulin resistance in fat cells results inhydrolysis of stored triglycerides, which elevates free fatty acidsin the blood plasma. Insulin resistance in muscle reduces glucoseuptake whereas insulin resistance in liver reduces glucose storage,with both effects serving to elevate blood glucose. High plasmalevels of insulin and glucose due to insulin resistance often leadsto the metabolic syndrome and type II diabetes.

In one embodiment, this invention provides methods of treating,suppressing, inhibiting, reducing the severity, reducing theincidence, reducing the pathogenesis, or delaying onset of, interalia: (a) diabetes; (b) glucose intolerance; (c) hyperinsulinemia;(d) insulin resistance; (e) diabetic nephropathy, (f) diabeticneuropathy (g) fatty liver conditions; (h) cardiovascular disease;or (i) cachexia; via the administration of any SARM as hereindescribed and optionally other therapeutic agents, or compositionscomprising the same.

Diabetes and the liver obesity is typically associated withelevated levels of free fatty acid (FFAs) that promote lipidaccumulation and insulin resistance in target tissues, i.e. reducedaction of insulin primarily in skeletal muscle and liver. Aprominent role of insulin is to reduce glucose output from theliver. FFAs stimulate hepatic gluconeogenesis which per se does notlead to increased hepatic glucose output as long as it isparalleled by a decrease in hepatic glycogenolysis, a compensatoryprocess referred to as "hepatic autoregulation". FFAs stimulateinsulin secretion and insulin blocks glycogenolysis in part byinhibiting secretion of glucagon, an inducer of glycogenolysis.However, long-term elevated levels of FFAs leads to hepatic insulinresistance and thus breakdown of hepatic autoregulation, resultingin increased hepatic glucose production and development of type IIdiabetes. Fatty liver and hepatic insulin resistance is a majordriving force behind hyperglycemia and type II diabetes.

In one embodiment, this invention provides methods that inhibit(improve) the fatty liver, resulting in that the insulin resistancein the liver is inhibited (improved) and thereby solving the basicproblem in type II diabetes. In one embodiment, this inventionprovides a method of treating a human subject having diabetes. Inanother embodiment, the diabetes is a type I diabetes. In anotherembodiment, the diabetes is type II diabetes. In one embodiment,this invention provides a method of treating a human subject havingglucose intolerance. In one embodiment, this invention provides amethod of treating a hyperinsulinemia in a human subject. In oneembodiment, this invention provides a method of treating insulinresistance in a human subject. In another embodiment, treatment ofinsulin resistance is exemplified in Example 6. In one embodiment,this invention provides a method of treating diabetic nephropathyin a human subject. In one embodiment, this invention provides amethod of treating diabetic neuropathy in a human subject. In oneembodiment, this invention provides a method of treating diabeticretinopathy in a human subject. In one embodiment, this inventionprovides a method of treating cardiovascular disease in a humansubject.

In another embodiment, the methods of this invention comprising thestep of administering to said subject a selective androgen receptormodulator compound of formula S-(III):

##STR00056## or its isomer, pharmaceutically acceptable salt,pharmaceutical product, hydrate, N-oxide, or any combinationthereof.

In one embodiment this invention provides a method for a) treating,preventing, suppressing or inhibiting atherosclerosis; or b)treating, preventing, suppressing, or inhibiting liver damage dueto fat deposits; comprising the step of administering to thesubject a SARM as described herein and/or its analog, derivative,isomer, metabolite, pharmaceutically acceptable salt,pharmaceutical product, hydrate, N-oxide, prodrug, polymorph,crystal, or any combination thereof or a composition comprising thesame, in an amount effective to treat, prevent or inhibitatherosclerosis and liver damage due to fat deposit.

In one embodiment atherosclerosis refers to a slow, complex diseasethat may begin with damage to the innermost layer of the artery. Inanother embodiment the causes of damage to the arterial wall mayinclude; a) elevated levels of cholesterol and in the blood; b)high blood pressure; c) tobacco smoke; or d) diabetes. In anotherembodiment, the condition is treatable in a smoker, despite thefact that tobacco smoke may greatly worsen atherosclerosis andspeed its growth in the coronary arteries, the aorta and arteriesin the legs. Similarly, in another embodiment, the methods of thisinvention may be useful in treating subjects with a family historyof premature cardiovascular disease who have an increased risk ofatherosclerosis.

In one embodiment liver damage due to fat deposits refer to thebuild-up of fat in the liver cells forming a fatty liver which maybe associated with or may lead to inflammation of the liver. Thiscan cause scarring and hardening of the liver. When scarringbecomes extensive, it is called cirrhosis.

In another embodiment the fat accumulates in the liver as obesity.In another embodiment fatty liver is also associated with diabetesmellitus, high blood triglycerides, and the heavy use of alcohol.In another embodiment fatty liver may occur with certain illnessessuch as tuberculosis and malnutrition, intestinal bypass surgeryfor obesity, excess vitamin A in the body, or the use of certaindrugs such as valproic acid (trade names:Depakene.RTM./Depakote.RTM.) and corticosteroids (cortisone,prednisone). Sometimes fatty liver occurs as a complication ofpregnancy.

Androgen-dependent conditions which may be treated with thecompounds and/or compositions as herein described, comprising themethods of the present invention include those conditions which areassociated with aging. In one embodiment, the SARM as describedherein is useful in: a) age-related functional decline (ARFD); b)reversal or prevention of ARFD; c) reversal or prevention of ARFDin elderly; d) reversal or prevention of ARFD-induced sarcopenia orosteopenia; e) andropause or andropausal vasomotor symptoms; f)andropausal gynecomastia, muscle strength/function; g) bonestrength/function; h) anger; i) asthenia; j) chronic fatiguesyndrome; k) cognitive impairment; and/or l) improving cognitivefunction.

In one embodiment, the SARM compounds as described herein areuseful in treating inflammation and related disorders such as: a)prevention, treatment, or reversal of arthritis; b) prevention,treatment, or reveral of an arthritic condition such as Behcet'sdisease (autoimmune vasculitis), bursitis, calcium pyrophosphatedihydrate crystal (CPPD), deposition disease (or pseudogout),carpal tunnel syndrome, connective tissue disorders, Crohn'sdiseases, Ehlers-Danlos syndrome (EDS), fibromyalgia, gout,infectious arthritis, inflammatory bowel disease (IBD), juvenilearthritis, systemic lupus erythematosus (SLE), Lyme's disease,Marfan syndrome, myositis, osteoarthritis, polyarteritis nodosa,polymyalgia rheumatica, psoriasis, psoriatic arthritis, Raynaud'sphenomenon, reflex sympathetic dystrophy syndrome, Reiter'ssyndrome, rheumatoid arthritis, scleroderma, Sjogrens' syndrome,tendonitis or ulcerative colitis; or c) preventing, treatment, orreversing an autoimmune disease.

In one embodiment, the compositions as described herein are usefulin prevention of iatrogenic effects comprising acute fatiguesyndrome (post-surgical) or androgen-deprivation therapy (ADT)induced side effects such as reduced muscle mass, reduced musclestrength, frailty, hypogonadism, osteoporosis, osteopenia,decreased bone mineral density and/or decreased bone mass.

In one embodiment, the methods of the present invention compriseadministering a SARM compound as the sole active ingredient.However, also encompassed within the scope of the present inventionare methods for diabetes and related disorders, hormone therapy,dry eye, obesity, treating prostate cancer, delaying theprogression of prostate cancer, and for preventing and/or treatingthe recurrence of prostate cancer, male contraception; treatment ofosteoporosis, treatment of conditions associated with ADIF and fortreatment and/or prevention of chronic muscular wasting whichcomprise administering the SARM compounds in combination with oneor to more therapeutic agents. These agents include, but are notlimited to: LHRH analogs, reversible antiandrogens, antiestrogens,anticancer drugs, 5-alpha reductase inhibitors, aromataseinhibitors, progestins, agents acting through other nuclear hormonereceptors, selective estrogen receptor modulators (SERM),progesterone, estrogen, PDE5 inhibitors, apomorphine,bisphosphonate, and one or more additional SARMS.

Thus, in one embodiment, the methods of the present inventioncomprise administering the SARM compound, comprise administering aSARM compound in combination with diabetes drug such astroglitazone, rosiglitazone, and pioglitazone. In anotherembodiment, the methods of the present invention compriseadministering a SARM compound in combination with an LHRH analog.In another embodiment, the methods of the present inventioncomprise administering a SARM compound, in combination with areversible antiandrogen. In another embodiment, the methods of thepresent invention comprise administering a SARM compound, incombination with an antiestrogen. In another embodiment, themethods of the present invention comprise administering a SARMcompound, in combination with an anticancer drug. In anotherembodiment, the methods of the present invention compriseadministering a SARM compound, in combination with achemotherapeutic agent. In another embodiment, the chemotherapeuticagent comprises: bendamustine, bevacizumab, bleomycin, calciumfolinate, capecitabine, carboplatin, cetuximab, chlorambucil,cisplatin, cyclophosphamide, cytarabine, dasatinib, docetaxel,doxorubicin, erlotinib, etoposide, fludarabine, fluorouracil,gemcitabine hydrochloride, irinotecan hydrochloride, lapatinib,methotrexate, methylprednisolone acetate, mitoxantrone,mitoxantrone hydrochloride, oxaliplatin, pacl*taxel, pamidronatedisodium, panitumumab, pemetrexed, prednisone, rituximab,trastuzumab, vincristine, vinorelbine or any combination thereof.In another embodiment, the methods of the present inventioncomprise administering a SARM compound, in combination with a5-alpha reductase inhibitor. In another embodiment, the methods ofthe present invention comprise administering a SARM compound, incombination with an aromatase inhibitor. In another embodiment, themethods of the present invention comprise administering a SARMcompound, in combination with a progestin. In another embodiment,the methods of the present invention comprise administering a SARMcompound, in combination with an agent acting through other nuclearhormone receptors. In another embodiment, the methods of thepresent invention comprise administering a SARM compound, incombination with a selective estrogen receptor modulator (SERM). Inanother embodiment, the methods of the present invention compriseadministering a SARM compound, in combination with a progesterone.In another embodiment, the methods of the present inventioncomprise administering a SARM compound, in combination with anestrogen. In another embodiment, the methods of the presentinvention comprise administering a SARM compound, in combinationwith a PDE5 inhibitor. In another embodiment, the methods of thepresent invention comprise administering a SARM compound, incombination with apomorphine. In another embodiment, the methods ofthe present invention comprise administering a SARM compound, incombination with a bisphosphonate. In another embodiment, themethods of the present invention comprise administering a SARMcompound, in combination with one or more additional SARMS. In someembodiments, the methods of the present invention comprise combinedpreparations comprising a SARM compound and an agent as describedhereinabove. In some embodiments, the combined preparations can bevaried, e.g., in order to cope with the needs of a patientsubpopulation to be treated or the needs of the single patientwhich different needs can be due to the particular disease,severity of the disease, age, sex, or body weight as can be readilydetermined by a person skilled in the art. In some embodiments, themethods of the present invention comprise personalized medicinemethods which treat the needs of a single patient. In oneembodiment, different needs can be due to the particular disease,severity of the disease, the overall medical state of a patient, orthe age of the patient. In some embodiments, personalized medicineis the application of genomic data to better target the delivery ofmedical interventions. Methods of personalized medicine, in someembodiments, serve as a tool in the discovery and clinical testingof new products of the present invention. In one embodiment,personalized medicine involves the application of clinically usefuldiagnostic tools that may help determine a patient's predispositionto a particular disease or condition. In some embodiments,personalized medicine is a comprehensive approach utilizingmolecular analysis of both patients and healthy individuals toguide decisions throughout all stages of the discovery anddevelopment of pharmaceuticals and diagnostics; and applying thisknowledge in clinical practice for a more efficient delivery ofaccurate and quality healthcare through improved prevention,diagnosis, treatment, and monitoring methods.

Age and health related conditions are associated with deteriorationin physical function and health-related quality of life. Physicalfunctional decline may impact on the quality of life. Physicalfunction is associated with quality of life.

In one embodiment, the term "physical function" refers to thephysical performance, and the physiological capacity, which refersto "the basic cellular & anatomic function such as cardiacejection fraction, nerve conduction velocity, or muscle strengthper cross-sectional area. Physical performance is the ability tointegrate these physiological systems into coordinated, efficientmovements to achieve optimum physical function. In anotherembodiment, physical function can also be defined as the ability toperform mobility tasks, activities of daily living, andinstrumental activities of daily living that are important forachieving & maintaining an independent living status. In antherembodiment, the physical function of a subject can be analyzed bythe time (speed) the activity (function) is performed, and/or bythe power (energy) or work the subject used in order to perform theactivity. Different physical functions include: walking, running,stair climb, weight lifting, grip strength, etc. In anotherembodiment, the physical function is as described in Example 4.

In one embodiment, this invention provides a method of treating,reducing the severity of, reducing the incidence of, or delayingthe onset of loss of physical function in a subject, comprising thestep of administering to said subject a compound of this invention.In another embodiment, said method comprising administering aselective androgen receptor modulator (SARM) compound of formulaII:

##STR00057## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isan alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is allyl, halogen, N(R).sub.2,CN, NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR,CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3,NHSO.sub.2R, OR, COR, OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines, ether, alkyl, N-sulfonyl,O-sulfonyl, alkylsulfonyl, carbonyl, or a ketone; wherein saidsubject is subjected to cancer therapy.

In another embodiment, Q is CN.

In another embodiment, said method comprising administering aselective androgen receptor modulator (SARM) compound of formulaS-(III):

##STR00058##

In one embodiment, this invention provides a method of treating,reducing the severity of reducing the incidence of, or delaying theonset of loss of physical function in a subject suffering fromcancer, comprising the step of administering to said subject acompound of this invention. In another embodiment, said methodcomprising administering a selective androgen receptor modulator(SARM) compound of formula II:

##STR00059## wherein X is O; Z is a hydrogen bond acceptor,NO.sub.2, CN, COR, or CONHR; Y is a lipid soluble group, an alkyl,CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl, halogen, N(R).sub.2,CN, NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR.CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3,NHSO.sub.2R, OR, COR, OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines, ether, alkyl N-sulfonyl,O-sulfonyl, alkylsulfonyl, carbonyl, or a ketone; wherein saidsubject is subjected to cancer therapy.

In another embodiment, Q is CN.

In another embodiment, said method comprising a selective androgenreceptor modulator (SARM) compound of formula S-(III):

##STR00060##

In another embodiment, said subject suffers from non-small celllung cancer. In another embodiment the subject suffers from coloncancer. In another embodiment the subject suffers from breastcancer. In another embodiment the subject suffers fromnon-Hodgkin's lymphoma. In another embodiment the subject sufferschronic lymphocytic leukemia. In another embodiment the subjectsuffers from lung cancer. In another embodiment, the lung cancerpatient is subjected to a cancer therapy. In another embodiment,the lung cancer patient is subjected to radiation therapy. Inanother embodiment, the compound is administered in combinationwith radiation therapy. In another embodiment, the compound isadministered in combination with a chemotherapeutic agent. Inanother embodiment, the chemotherapeutic agent comprises:bendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab, chlorambucil, cisplatin,cyclophosphamide, cytarabine, dasatinib, docetaxel, doxorubicin,erlotinib, etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib, methotrexate,methylprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof. In anotherembodiment, the chemotherapeutic agent comprises platinum andtaxane. In another embodiment, the chemotherapeutic agent comprisesplatinum and non-taxane chemotherapeutic agent.

In another embodiment, said method further increases the survivalof said subject. In another embodiment, said method furtherincreases lean body mass of a subject.

In another embodiment, the loss of physical function is due tocancer or cancer therapy (radiation, chemotherapy, surgery).

In one embodiment, this invention provides a method of increasingthe physical function of a subject suffering from cancer,comprising the step of administering to said subject a compound ofthis invention. In another embodiment, said method comprisesadministering a selective androgen receptor modulator (SARM)compound of formula II:

##STR00061## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isan alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, I, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl, halogen, N(R).sub.2,CN, NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR,CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3,NHSO.sub.2R, OR, COR, OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines, ether, alkyl, N-sulfonyl,O-sulfonyl, alkylsulfonyl, carbonyl, or a ketone; wherein saidsubject is subjected to cancer therapy.

In another embodiment, Q is CN.

In another embodiment, said method comprising administering aselective androgen receptor modulator (SARM) compound of formulaS-(III):

##STR00062##

In another embodiment, said subject suffers from non-small celllung cancer. In another embodiment the subject suffers from coloncancer. In another embodiment the subject suffers from breastcancer. In another embodiment the subject suffers fromnon-Hodgkin's lymphoma. In another embodiment the subject sufferschronic lymphocytic leukemia. In another embodiment the subjectsuffers from lung cancer. In another embodiment, the lung cancerpatient is subjected to a cancer therapy. In another embodiment,the lung cancer patient is subjected to radiation therapy. Inanother embodiment, the compound is administered in combinationwith radiation therapy. In another embodiment, the compound isadministered in combination with a chemotherapeutic agent. Inanother embodiment, the chemotherapeutic agent comprises:bendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab, chlorambucil, cisplatin,cyclophosphamide, cytarabine, dasatinib, docetaxel, doxorubicin,erlotinib, etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib, methotrexate,methylprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof. In anotherembodiment, the chemotherapeutic agent comprises platinum andtaxane. In another embodiment, the chemotherapeutic agent comprisesplatinum and non-taxane chemotherapeutic agent. In anotherembodiment, said method further improves the quality of life ofsaid subject. In another embodiment, said method further increasesthe survival of said subject. In another embodiment, said methodfurther increases lean body mass of a subject.

In one embodiment, this invention provides a method of improvingthe quality of life of a subject suffering from cancer, comprisingthe step of administering to said subject a compound of thisinvention. In another embodiment, said method comprisingadministering a compound of this invention. In another embodiment,said method comprises administering a selective androgen receptormodulator (SARM) compound of formula II:

##STR00063## wherein X is O; Z is NO.sub.2, CN, COR, or CONHR; Y isan alkyl, CF.sub.3, CH.sub.3, formyl, alkoxy, H, F, 1, Br, Cl, orSn(R).sub.3; R is an alkyl, aryl, phenyl, alkenyl, haloalkyl,haloalkenyl, halogen or OH; and Q is alkyl, halogen, N(R).sub.2,CN, NHCOCH.sub.3, NHCOCF.sub.3, NHCOR, NHCONHR, NHCOOR, OCONHR.CONHR, NHCSCH.sub.3, NHCSCF.sub.3, NHCSR, NHSO.sub.2CH.sub.3,NHSO.sub.2R, OR, COR, OCOR, OSO.sub.2R, SO.sub.2R, SR, acetamido-,trifluoroacetamido-, alkylamines, ether, alkyl, N-sulfonyl,O-sulfonyl, alkylsulfonyl, carbonyl, or a ketone; wherein saidsubject is subjected to cancer therapy.

In another embodiment, Q is CN.

In another embodiment, said method comprising administering aselective androgen receptor modulator (SARM) compound of formulaS-(III):

##STR00064##

In another embodiment, said subject suffers from non-small celllung cancer. In another embodiment the subject suffers from coloncancer. In another embodiment the subject suffers from breastcancer. In another embodiment the subject suffers fromnon-Hodgkin's lymphoma. In another embodiment the subject sufferschronic lymphocytic leukemia. In another embodiment the subjectsuffers from lung cancer. In another embodiment, the lung cancerpatient is subjected to a cancer therapy. In another embodiment,the lung cancer patient is subjected to radiation therapy. Inanother embodiment, the compound is administered in combinationwith radiation therapy. In another embodiment, the compound isadministered in combination with a chemotherapeutic agent. Inanother embodiment, the chemotherapeutic agent comprises:bendamustine, bevacizumab, bleomycin, calcium folinate,capecitabine, carboplatin, cetuximab, chlorambucil, cisplatin,cyclophosphamide, cytarabine, dasatinib, docetaxel, doxorubicin,erlotinib etoposide, fludarabine, fluorouracil, gemcitabinehydrochloride, irinotecan hydrochloride, lapatinib, methotrexate,methylprednisolone acetate, mitoxantrone, mitoxantronehydrochloride, oxaliplatin, pacl*taxel, pamidronate disodium,panitumumab, pemetrexed, prednisone, rituximab, trastuzumab,vincristine, vinorelbine or any combination thereof. In anotherembodiment, the chemotherapeutic agent comprises platinum andtaxane. In another embodiment, the chemotherapeutic agent comprisesplatinum and non-taxane chemotherapeutic agent. In anotherembodiment, said method further increases the survival of saidsubject. In another embodiment, said method further increases leanbody mass of a subject.

In one embodiment, this invention provide increase in the physicalfunction of a subject suffering from cancer and increasing thequality of life of said subject as disclosed in Examples 11, 12,and 15 and in FIGS. 19, 35 and 36.

In one embodiment, this invention provides a method of increasingof the physical function of a subject. In another embodiment, saidmethod further comprising an increase of the quality of life ofsaid subject. In another embodiment, said subject suffers fromnon-small cell lung cancer. In another embodiment the subjectsuffers from colon cancer. In another embodiment the subjectsuffers from breast cancer. In another embodiment the subjectsuffers from non-Hodgkin's lymphoma. In another embodiment thesubject suffers chronic lymphocytic leukemia. In another embodimentthe subject suffers from lung cancer. In another embodiment, thelung cancer patient is subjected to a cancer therapy. In anotherembodiment, the lung cancer patient is subjected to radiationtherapy. In another embodiment, said method further increases thesurvival of said subject with cancer.

In one embodiment, this invention is directed to increasing thesurvival of a subject that suffers from cancer.

The term "increase survival" refers to increase in the timespan orduration of time that a patient is alive following diagnosis ortherapy for a disease, which may include a longer duration withoutdisease progression or mortality.

In another embodiment, said subject suffers from non-small celllung cancer. In another embodiment the subject suffers from coloncancer. In another embodiment the subject suffers from breastcancer. In another embodiment the subject suffers fromnon-Hodgkin's lymphoma. In another embodiment the subject sufferschronic lymphocytic leukemia. In another embodiment the subjectsuffers from lung cancer. In another embodiment, said methodcomprises using a compound of this invention. In anotherembodiment, said method comprises administering a compound offormula II. In another embodiment, said method comprisesadministering a compound of formula II in combination with achemotherapeutic agent. In another embodiment, said methodcomprises administering a compound of formula II in combinationwith radiation therapy. In another embodiment, said methodcomprises administering a compound of formula S-(III). In anotherembodiment, said method comprises administering a compound offormula S-(III) in combination with a chemotherapeutic agent. Inanother embodiment, said method comprises administering a compoundof formula S-(III) in combination with taxane and platinum. Inanother embodiment, said method comprises administering a compoundof forma S-(III) in combination with platinum and non-taxanechemotherapeutic agents. In another embodiment, said methodcomprises administering a compound of formula S-(III) incombination with radiation therapy.

In one embodiment, the methods of this invention compriseadministering a compound of this invention and/or its isomer,pharmaceutically acceptable salt, pharmaceutical product, hydrate,N-oxide, or any combination thereof; and a pharmaceuticallyacceptable carrier.

In one embodiment, the methods of this invention compriseadministering a compound of this invention and/or its isomer,pharmaceutically acceptable salt, pharmaceutical product, hydrate,N-oxide, or any combination thereof, at least one chemotherapeuticagent, and a pharmaceutically acceptable carrier.

It is to be understood that any use of any of the SARMs as hereindescribed can be used in the treatment of any disease, disorder orcondition as described herein, and represents an embodiment of thisinvention.

The following examples are presented in order to more fullyillustrate the preferred embodiments of the invention. They shouldin no way, however, be construed as limiting the broad scope of theinvention.

EXAMPLE

Example 1

Synthesis of (S) Enantiomer of Compound of Formula S-(III)

##STR00065##

(2R)-1-Methacryloylpyrrolidin-2-carboxylic Acid

D-Proline, 14.93 g, 0.13 mol) was dissolved in 71 mL of 2 N NaOHand cooled in an ice bath; the resulting alkaline solution wasdiluted with acetone (71 mL). An acetone solution (71 mL) ofmethacryloyl chloride (13.56 g, 0.13 mol) and 2 N NaOH solution (71mL) were simultaneously added over 40 min to the aqueous solutionof D-proline in an ice bath. The pH of the mixture was kept at10-11.degree. C. during the addition of the methacryloyl chloride.After stirring (3 h, room temperature), the mixture was evaporatedin vacuo at a temperature at 35-45.degree. C. to remove acetone.The resulting solution was washed with ethyl ether and wasacidified to pH 2 with concentrated HCl. The acidic mixture wassaturated with NaCl and was extracted with EtOAc (100 mL.times.3).The combined extracts were dried over Na.sub.2SO.sub.4, filteredthrough Celite.RTM., and evaporated in vacuo to give the crudeproduct as a colorless oil. Recrystallization of the oil from ethylether and hexanes afforded 16.2 g (68%) of the desired compound ascolorless crystals: mp 102-103.degree. C. (lit. mp102.5-103.5.degree. C.); the NMR spectrum of this compounddemonstrated the existence of two rotamers of the title compound..sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta. 5.28 (s) and 5.15 (s)for the first rotamer, 5.15 (s) and 5.03 (s) for the second rotamer(totally 2H for both rotamers, vinyl CH.sub.2), 4.48-4.44 for thefirst rotamer, 4.24-4.20 (m) for the second rotamer (totally 1H forboth rotamers, CH at the chiral canter), 3.57-3.38 (m, 2H,CH.sub.2), 2.27-2.12 (1H, CH), 1.97-1.72 (m, 6H, CH.sub.2, CH, Me);.sup.13C NMR (75 MHz, DMSO-d.sub.6) .delta. for major rotamer173.3, 169.1, 140.9, 116.4, 58.3, 48.7, 28.9, 24.7, 19.5: for minorrotamer 174.0, 170.0, 141.6, 115.2, 60.3, 45.9, 31.0, 22.3, 19.7;IR (KBr) 3437 (OH), 1737 (C.dbd.O), 1647 (CO, COOH), 1584, 1508,1459, 1369, 1348, 1178 cm.sup.-1; [.alpha.].sub.D.sup.26+80.8.degree. (c=1, MeOH); Anal. Calcd. forC.sub.9H.sub.13NO.sub.3: C, 59.00, H, 7.15, N, 7.65. Found: C,59.13, H, 7.19, N, 7.61.

##STR00066##

(3R,8aR)-3-Bromomethyl-3-methyl-tetrahydro-pyrrolo[2,1-c][1,4]oxazine-1,4--dione

A solution of NBS (23.5 g, 0.132 mol) in 100 mL of DMF was addeddropwise to a stirred solution of the (methyl-acryloyl)-pyrrolidine(16.1 g, 88 mmol) in 70 mL of DMF under argon at room temperature,and the resulting mixture was stirred 3 days. The solvent wasremoved in vacuo, and a yellow solid was precipitated. The solidwas suspended in water, stirred overnight at room temperature,filtered, and dried to give 18.6 g (81%) (smaller weight when dried.about.34%) of the title compound as a yellow solid: mp152-154.degree. C.; .sup.1H NMR (300 MHz, DMSO-d.sub.6) .delta.4.69 (dd, J=9.6 Hz, J=6.7 Hz, 1H, CH at the chiral center), 4.02(d, J=11.4 Hz, 1H, CHH.sub.a), 3.86 (d, J=11.4 Hz, 1H, CHH.sub.b),3.53-3.24 (m, 4H, CH.sub.2), 2.30-2.20 (m, 1H, CH), 2.04-1.72 (m,3H, CH.sub.2 and CH), 1.56 (s, 2H, Me); .sup.13C NMR (75 MHz,DMSO-d.sub.6) .delta. 167.3, 163.1, 83.9, 57.2, 45.4, 37.8, 29.0,22.9, 21.6; IR (KBr) 3474, 1745 (C.dbd.O), 1687 (C.dbd.O), 1448,1377, 1360, 1308, 1227, 1159, 1062 cm.sup.-1;[.alpha.].sub.D.sup.26 +124.5.degree. (c=1.3, chloroform); Anal.Calcd. for C.sub.9H.sub.12BrNO.sub.3: C, 41.24, H, 4.61, N, 5.34.Found: C, 41.46, H, 4.64, N, 5.32.

##STR00067##

(2R)-3-Bromo-2-hydroxy-2-methylpropanoic Acid

A mixture of bromolactone (18.5 g, 71 mmol) in 300 mL of 24% HBrwas heated at reflux for 1 h. The resulting solution was dilutedwith brine (200 mL), and was extracted with ethyl acetate (100mL.times.4). The combined extracts were washed with saturatedNaHCO.sub.3 (100 mL.times.4). The aqueous solution was acidifiedwith concentrated HCl to pH=1, which, in turn, was extracted withethyl acetate (100 mL.times.4). The combined organic solution wasdried over Na.sub.2SO.sub.4, filtered through Celite.RTM., andevaporated in vacuo to dryness. Recrystallization from tolueneafforded 10.2 g (86%) of the desired compound as colorlesscrystals: mp 107-109.degree. C.; .sup.1H NMR (300 MHz,DMSO-d.sub.6) .delta. 3.63 (d, J=10.1 Hz, 1H, CHH.sub.a), 3.52 (d,J=10.1 Hz, 1H, CHH.sub.b), 1.35 (s, 3H, Me); IR (KBr) 3434 (OH),3300-2500 (COOH), 1730 (C.dbd.O), 1449, 1421, 1380, 1292, 1193,1085 cm.sup.-1; [.alpha.].sub.D.sup.26 +10.5.degree. (c=2.6, MeOH);Anal. Calcd. for C.sub.4H.sub.7BrO.sub.3: C, 26.25, H, 3.86. Found:C, 26.28, H, 3.75.

##STR00068##

Synthesis of(2R)-3-Bromo-N-[4-cyano-3-(trifluoromethyl)phenyl]-2-hydroxy-2-methylprop-anamide

Thionyl chloride (46.02 g, 0.39 mol) was added dropwise to a cooledsolution (less than 4.degree. C.) of(R)-3-bromo-2-hydroxy-2-methylpropanoic acid (51.13 g, 0.28 mol) in300 mL of THF under an argon atmosphere. The resulting mixture wasstirred for 3 h under the same condition. To this was addedEt.sub.3N (39.14 g, 0.39 mol) and stirred for 20 min under the samecondition. After 20 min, 5-amino-2-cyanobenzotrifluoride (40.0 g,0.21 mol), 400 mL of THF were added and then the mixture wasallowed to stir overnight at room temperature. The solvent wasremoved under reduced pressure to give a solid which was treatedwith 300 mL of H.sub.2O, extracted with EtOAc (2.times.400 mL). Thecombined organic extracts were washed with saturated NaHCO.sub.3solution (2.times.300 mL) and brine (300 mL). The organic layer wasdried over MgSO.sub.4 and concentrated under reduced pressure togive a solid which was purified from column chromatography usingCH.sub.2Cl.sub.2/EtOAc (80:20) to give a solid. This solid wasrecrystallized from CH.sub.2Cl.sub.2/hexane to give 55.8 g (73.9%)of(2R)-3-bromo-N-[4-cyano-3-(trifluoromethyl)phenyl]-2-hydroxy-2-methylprop-anamide as a light-yellow solid.

.sup.1H NMR (CDCl.sub.3/TMS) .delta. 1.66 (s, 3H, CH.sub.3), 3.11(s, 1H, OH), 3.63 (d, J=10.8 Hz, 1H, CH.sub.2), 4.05 (d, J=10.8 Hz,1H, CH.sub.2), 7.85 (d, J=8.4 Hz, 1H, ArH), 7.99 (dd, J=2.1, 8.4Hz, 1H, ArH), 8.12 (d, J=2.1 Hz, 1H, ArH), 9.04 (bs, 1H, NH).Calculated Mass: 349.99, [M-H].sup.- 349.0. M.p.: 124-126.degree.C.

##STR00069##

Synthesis of(S)--N-(4-Cyano-3-(trifluoromethyl)phenyl)-3-(4-cyanophenoxy)-2-hydroxy-2--methylpropanamide

A mixture of bromoamide((2R)-3-bromo-N-[4-cyano-3-(trifluoromethyl)phenyl]-2-hydroxy-2-methylpro-panamide, 50 g, 0.14 mol), anhydrous K.sub.2CO.sub.3 (59.04 g, 0.43mol), 4-cyanophenol (25.44 g, 0.21 mol) in 500 mL of 2-propanol washeated to reflux for 3 h and then concentrated under reducedpressure to give a solid. The resulting residue was treated with500 mL of H.sub.2O and then extracted with EtOAc (2.times.300 mL).The combined EtOAc extracts were washed with 10% NaOH (4.times.200mL) and brine. The organic layer was dried over MgSO.sub.4 and thenconcentrated under reduced pressure to give an oil which wastreated with 300 mL of ethanol and an activated to carbon. Thereaction mixture was heated to reflux for 1 h and then the hotmixture was filtered through Celite.RTM.. The filtrate wasconcentrated under reduced pressure to give an oil. This oil waspurified by column chromatography using CH.sub.2Cl.sub.2/EtOAc(80:20) to give an oil which was crystallized fromCH.sub.2Cl.sub.2/hexane to give 33.2 g (59.9%) of(S)--N-(4-cyano-3-(trifluoromethyl)phenyl)phenyl)-3-(4-cyanophenoxy)-2-hy-droxy-2-methylpropanamide as a colorless solid (a cotton type).

.sup.1H NMR (CDCl.sub.3/TMS) .delta. 1.63 (s, 3H, CH.sub.3), 3.35(s, 1H, CH.sub.3), 4.07 (d, J=9.04 Hz, 1H, CH), 4.51 (d, J=9.04 Hz,1H, CH), 6.97-6.99 (m, 2H, ArH), 7.57-7.60 (n, 2H, ArH), 7.81 (d,J=8.55 Hz, 1H, ArH), 7.97 (dd, J=1.95, 8.55 Hz, 1H, ArH), 8.12 (d,J=1.95 Hz, 1H, ArH), 9.13 (bs, 1H, NH). Calculated Mass: 389.10,[M-H].sup.- 388.1. Mp: 92-94.degree. C.

Example 2

Androgenic & Anabolic Activity of Compound of Formula S-(III)in Intact and Orchidectomized (ORX) Rat Subjects

Materials and Methods

Male Sprague-Dawley rats weighing approximately 200 g werepurchased from Harlan Bioproducts for Science (Indianapolis, Ind.).The animals were maintained on a 12 h light/dark cycle with food(7012C LM-485 Mouse/Rat Sterilizable Diet, Harlan Teklad, Madison,Wis.) and water available ad libitum. The animal protocol wasreviewed and approved. Anabolic and androgenic activity of Compoundof Formula S-(III) in intact animals was evaluated and alsocompared to oxandrolone, and the dose response in acutelyorchidectomized (ORX) animals was evaluated as well. Regenerativeeffects of Compound S-(III) in chronically (9 days) ORX rats werealso assessed.

The compound was weighed and dissolved in 10% DMSO (Fischer)diluted with PEG 300 (Acros Organics, NJ) for preparation of theappropriate dosage concentrations. The animals were housed ingroups of 2 to 3 animals per cage. Intact and ORX animals wererandomly assigned to one of seven groups consisting of 4 to 5animals per group. Control groups (intact and ORX) were adminsteredvehicle daily. Compound of formula S-(III) was administered viaoral gavage at doses of 0.01, 0.03, 0.1, 0.3, 0.75, and 1 mg/day toboth intact and ORX groups.

Castrated animals (on day one of the study) wee randomly assignedto dose groups (4-5 animals/group) of 0.01, 0.03, 0.1, 0.3, 0.75,and 1 mg/day, for dose-response evaluation. Dosing began nine dayspost ORX and was administered daily via oral gavage for fourteendays. The animals were sacrificed under anesthesia(ketamine/xylazine, 87:13 mg/kg) after a 14-day dosing regimen, andbody weighs wee recorded. In addition, ventral prostate, seminalvesicles, and levator ani muscle were removed, individuallyweighed, normalized to body weight, and expressed as a percentageof intact control Student's T-test was used to compare individualdose groups to the intact control group. Significance was defined apriori as a P-value <0.05. As a measure of androgenic activity,ventral prostate and seminal vesicle weights were evaluated,whereas levator ani muscle weight was evaluated as a measure ofanabolic activity. Blood was collected from the abdominal aorta,centrifuged, and sera were frozen at -80.degree. C. prior todetermination of serum hormone levels. Serum luteinizing hormone(LH) and follicle stimulating hormone (FSH) concentrations weedetermined.

Results

Prostate weighs of intact rats following compound of formulaS-(III) (Compound III) treatment were 111%.+-.21%, 88%.+-.15%,77%.+-.17%, 71%.+-.16%, 71%.+-.10%, and 87%.+-.13% of intactcontrols following doses of 0.01, 0.03, 0.1, 0.3, 0.75, and 1mg/day, respectively (FIG. 1). Similarly, seminal vesicle weightsof intact rats following Compound III treatment were decreased to94%.+-.9%, 77%.+-.11%, 80%.+-.9%, 73%.+-.12%, 77%.+-.10%, and88%.+-.14% of intact controls following doses of 0.01, 0.03, 0.1,0.3, 0.75, and 1 mg/day, respectively (FIG. 1). Significantincreases were seen in levator an muscle weights of sham animals,however, in all dose groups, when compared to intact controls.Levator ani in intact rats following Compound III treatment were120%.+-.12%, 116%.+-.7%, 128%.+-.7%, 134%.+-.7%, 125%.+-.9%, and146%.+-.17% of intact controls for the 0.01, 0.03, 0.1, 0.3, 0.75,and 1.0 mg/day doses, respectively (FIG. 1).

Compound III exhibited anabolic muscle/prostate ratio in castratedrats of 7.56, 4.28, 2.21, 2.19, 1.57 and 1.75 following doses of0.01, 0.03, 0.1, 0.3, 0.75 and 1 mg/day, respectively.

Compound III partially maintained prostate weight followingorchidectomy. Prostate weight in vehicle treated-ORX controlsdecreased to 5%.+-.1% of intact controls. At doses of 0.01, 0.03,0.1, 03, 0.75, and 1.0 mg/day, Compound III maintained prostateweights at 8%.+-.2%, 20%.+-.5%, 51%.+-.19%, 56%.+-.9%, 80%.+-.28%,and 74.+-.12.5% of intact controls, respectively (FIG. 2).

Compound III partially maintained seminal vesicle weights in ORXanimals, as well. While in castrated controls, seminal vesicleweight decreased to 13%.+-.2% of intact controls, Compound IIItreated animal weighs were 12%.+-.4%, 17%.+-.5%, 35%.+-.10%,61%.+-.15%, 70%.+-.14%, and 80%.+-.6% of intact controls, followingdoses of 0.01, 0.03, 0.1, 0.3, 0.75, and 1.0 mg/day, respectively(FIG. 2).

In ORX controls the levator ani muscle weight decreased to55%.+-.7% of intact controls, while Compound III treated animalsfully maintained and increased levator ani muscle weights at doses>0.1 mg/day, with observed muscle weights of 59%.+-.6%,85%.+-.9%, 112%.+-.10%, 122%.+-.16%, 127.+-.12%, and 130.+-.2% ofintact control weights for the 0.01, 0.03, 0.1, 03, 0.75, and 1.0mg/day dose groups, respectively (FIG. 2).

Pharmacology results following 1 mg/day of Compound III exhibitedthat prostate weight was 87%.+-.13% of intact control and levatorani muscle weight was 146%.+-.17% of intact control Compound III at1 mg/day maintained prostate weight following orchidectomy at74.+-.12.5% of intact controls and levator ani muscle weight at130.+-.2% of intact controls. 0.1 mg/day of Compound III restored112% of levator ani muscle weight, while 51.+-.20% of prostateweight was restored.

Oxandrolone treatment of ORX animals, was less anabolic thanCompound III, with levator ani weights being 50% of intactcontrols, and not dosage dependent when administered at 0.1-1mg/day (FIG. 3).

E.sub.max and ED.sub.50 were determined in each tissue by nonlinearregression analysis in WinNonlin.RTM. and presented in FIG. 4.E.sub.D50 indicates the dose of Compound III resulting in 50% ofthe maximal response, which is the E.sub.max. E.sub.max values were83%.+-.25%, 85%.+-.11%, and 131%.+-.2% for prostate, seminalvesicles, and levator ani, respectively. The ED.sub.50 in prostate,seminal vesicles, and levator ani was 0.09.+-.0.07, 0.17.+-.0.05,and 0.02.+-.0.01 mg/day, respectively.

Serum Hormone Analysis

Serum LH and FSH concentrations for the animals are presented inTable 1. LH decreased in a dose-dependent manner in both intact andcastrated animals, as a function of treatment with the compound.Following doses >0.1 mg/day, LH levels were below the limit ofquantitation (0.07 ng/mL). The 0.1 mg/day dose in ORX animalsreturned LH levels back to those seen in intact controls. Similareffects were observed with FSH. In intact animals, a significantdecrease in FSH levels was observed with the 0.75 and 1 mg/daydoses. In ORX animals, a dose-dependent decrease in FSH levels wasobserved. Doses of Compound of formula S-(III) (Compound III)>0.1 mg/day in ORX animals returned FSH levels to those ofintact controls.

TABLE-US-00001 TABLE 1 Serum LH and FSH levels from animals in Arm1 and Arm 2. Luteinizing Hormone Follicle Stimulating HormoneCompound III Intact ORX Intact ORX (mg/day) (ng/ml) (ng/ml) (ng/ml)(ng/ml) Vehicle 0.281 .+-. 0.126.sup.b 9.66 .+-. 1.13.sup.a 6.40.+-. 1.58.sup.b 43.45 .+-. 4.97.sup.a 0.01 0.195 .+-. 0.106.sup.b8.45 .+-. 2.44.sup.a 5.81 .+-. 0.31.sup.b 36.23 .+-. 7.75.sup.a0.03 0.176 .+-. 0.092.sup.b 4.71 .+-. 1.72.sup.a,b 5.74 .+-.0.78.sup.b 40.15 .+-. 3.33.sup.a 0.1 0.177 .+-. 0.058.sup.b 0.778.+-. 0.479.sup.b 6.60 .+-. 1.06.sup.b 20.69 .+-. 3.52.sup.a,b 0.3<LOQ <LOQ 5.32 .+-. 1.80.sup.b 8.73 .+-. 2.25.sup.b 0.75<LOQ <LOQ 4.30 .+-. 0.62.sup.a,b 7.19 .+-. 1.11.sup.b 1<LOQ <LOQ 4.38 .+-. 0.42.sup.a,b 6.33 .+-. 0.70.sup.b .sup.aP<0.05 vs. Intact Controls. .sup.bP <0.05 vs. ORX Controls.LOQ--limit of quantitation.

Androgenic & Anabolic Activity Following Delayed Dosing

After a delay of 9 days following orchidectomy (chronicallycastrated rats), Compound of formula S-(III) (Compound III)partially restored both prostate and seminal vesicle weight in ORXanimals. Prostate weights were restored to 9%.+-.3%, 11%.+-.3%,23%.+-.5%, 50%.+-.13%, 62%.+-.12%, and 71%.+-.5%, while seminalvesicle weights were restored 7%.+-.1%, 9%.+-.1%, 23%.+-.8%,49%.+-.5%, 67%.+-.12%, and 67%.+-.11% of intact controls for 0.01,0.03, 0.1, 0.3, 0.75, and 1.0 mg/day dose groups, respectively.Compound III fully restored levator ani muscle weight at doses>0.1 mg/day. Levator ani muscle weights were restored to56%.+-.7%, 82%.+-.9%, 103%.+-.11%, 113%.+-.11%, 121%.+-.7%, and120%.+-.7% corresponding to doses of 0.01, 0.03, 0.1, 0.3, 0.75,and 1.0 mg/day, respectively. Results are presented graphically inFIG. 5. E.sub.max and ED.sub.50 values were determined in eachtissue by nonlinear regression analysis in WinNonlin.RTM. andpresented in FIG. 6. E.sub.max values were 75%.+-.8%, 73%.+-.3%,and 126%.+-.4% for prostate, seminal vesicles, and levator ani,respectively. The ED.sub.50 in prostate, seminal vesicles, andlevator ani was 0.22.+-.0.05, 0.21.+-.0.02, and 0.013.+-.0.01mg/day, respectively.

Example 3

SARM Reduction of Cholesterol Levels

Materials and Methods

One hundred Sprague Dawley rats (50 male and 50 female) weredivided into five groups (n=10 per gender per group), representingvehicle only (PEG300:40% Cavasol.RTM. [75/25 (v/v)]), and four dosegroups of Compound of formula S-(III) (Compound III). Animals wereadministered Compound III once daily by oral gavage according totheir most recent body weight with doses of either 0, 3, 10, 30 or100 mg/kg. During the study period, rats had access to water and astandard laboratory diet of Harlan Taklad Rodent Chow ad libitum.After 28 consecutive days of dosing, animals were fasted overnight,blood samples were collected and serum was obtained. Serum levelsof total cholesterol were determined using an automated laboratoryassay method.

Results

The male and female rats in the vehicle only group (0 mg/kg) hadserum total cholesterol values of 92.+-.13.5 and 102.+-.13 mg/dLrespectively. These values are considered within the normalhistorical range for the testing laboratory. Daily oral doses ofCompound III at or above 3 mg/kg caused a significant reduction intotal cholesterol levels in both male and female rats. At 3 mg/kg,compared to vehicle control animals, an approximate 30% reductionin total cholesterol was noted where males and females had63.+-.17.4 and 74.+-.14.2 mg/dL respectively. Although a slightlygreater effect was noted at the highest dose group (100 mg/kg perday), in general, a dose-response relationship was not observed inthe reduction of total cholesterol levels in the Sprague Dawleyrat. Results are presented graphically in FIG. 7.

Example 4

SARM Promotion of Lean Mass and Reduction of Fat Mass in HumanClinical Trials

Five groups of 24 human subjects per group (12 males and 12females) of 60 elderly men (age >60) and 60 postmenopausal women(not hypogonadal, not osteoporotic, no exercise program, nocontrolled diet) were dosed each in a randomized, double-blindstudy design. Each subject received 0.1 mg, 0.3 mg, 1 mg, or 3 mgCompound III (or placebo of equal volume) in solution or inexperimental capsules for 90 days treatment. Total lean body mass(DEXA=dual energy x-ray absorptiometry), fat mass and performancewere analyzed.

Results

Total Lean Mass (DEXA) Effects

All subjects (average age=64 years)(n=114) exhibited adose-dependent increase in Lean Body Mass (LBM) following treatmentwith 0.1 rag, 0.3 mg, 1 mg and 3 mg of Compound of formula S-(III)(Compound III) (FIG. 8).

Treatment with 3 mg Compound III exhibited LBM increase of about3.1.+-.3.4% compared to baseline with a p<0.0001 (ANOVA). The 1mg dose of Compound III exhibited an increase of 1.3.+-.2.7%compared to baseline with a p=0.020 (ANOVA) (Table 2).

TABLE-US-00002 TABLE 2 Placebo 0.1 mg 0.3 mg 1 mg 3 mg Baseline44615 .+-. 96.7 46400 .+-. 9350 45258 .+-. 10103 48154 .+-. 1059045031 .+-. 10255 Mean .+-. SD (g) Mean -73.2 .+-. 1126.8 164.0 .+-.868.2 78.0 .+-. 1150.3 588.7 .+-. 1257.5 1246.3 .+-. 1288.0absolute change from baseline .+-. SD (g) p-value 0.474 0.651 0.055<0.001 (compared to placebo) p-value 0.754 0.838 0.741 0.020<0.0001 (compared to baseline) Mean % 0.1 .+-. 2.7 0.3 .+-. 2.00.4 .+-. 2.7 1.3 .+-. 2.7 3.1 .+-. 3.4 change from baseline .+-.SD

Females (average age 63 years)(n=56) exhibited a dose-dependentincrease in LBM when administered a 3 mg dose of Compound III, withan increase of 1.7 kg compared to baseline and an increase of 1.4kg compared to placebo with a p=0.02 (ANOVA). Females administeredthe 1 mg dose of Compound III exhibited an increase of 0.4 kgcompared to baseline and no changes compared to placebo with ap=0.884 (ANOVA).

Males (Average age 66 years) (n=58) exhibited a dose-dependentincrease in LBM when administered a 1 mg dose of Compound III, withan increase of 0.7 kg compared to baseline and an increase of 1.2kg compared to placebo with a p=0.03 (ANOVA). Males administeredthe 3 mg dose of Compound III exhibited an increase of 1 kgcompared to baseline and an increase of 1.4 kg compared to placebowith a p=0.005 (ANOVA).

Fat Mass (DEXA) Effects

All subjects exhibited a dose-dependent decrease in total fat forthe 0.3 mg, 1 mg and 3 mg doses of Compound III with p=0.242, 0.085and 0.049 respectively. All subjects exhibited an increase in fatmass for the 0.1 mg (FIG. 9). At 3 mg, the loss was 0.6 kg comparedto placebo and 0.3 kg (0.4%) from baseline with a p=0.049 (Table3).

TABLE-US-00003 TABLE 3 Placebo 0.1 mg 0.3 mg 1 mg 3 mg (gr) (gr)(gr) (gr) (gr) Baseline 20807 .+-. 8689 23355 .+-. 6019 21555 .+-.6694 22561 .+-. 5659 20493 .+-. 6932 Mean .+-. SD (g) Mean 304.7.+-. 1105.2 222.47 .+-. 958.0 -65.4 .+-. 1055.0 -255.1 .+-. 948.0-321.9 .+-. 1282.0 absolute change from baseline .+-. SD (g)p-value 0.793 0.242 0.085 0.049 (compared to placebo) Mean % 1.3.+-. 7.1 1.3 .+-. 5.1 0.2 .+-. 5.1 -1.3 .+-. 4.4 -0.4 .+-. 6.9change from baseline .+-. SD

The site of fat loss was different among males and females. Malestended to lose from the trunk/abdomen about 1.4 kg compared to theplacebo (and 0.5 kg from baseline) with 3 mg (p=0.237) and 1.7 kgcompared to the placebo (and 0.8 kg from baseline) with 1 mg(p=0.810) doses. Females tended to lose from the thigh and legsabout 1 kg compared to the placebo (and 0.5 kg from baseline) with1 mg (p=0.038) and 3 mg (p=0.212) doses (Table 4).

TABLE-US-00004 TABLE 4 Placebo 1 mg 3 mg Females (g) 529 .+-. 1210-514 .+-. 941 -50.2 .+-. 909 0.038 0.212 Males (g) 91.8 .+-. 1013-8.26 .+-. 949 -540 .+-. 1486 0.810 0.237

Total tissue percent fat, relative to lean muscle mass decreased ina dose-dependent fashion, at the 1 mg dose achieving p=0.02 (ANOVA)and at 3 mg, achieving p=0.006 (ANOVA) for all subjects. Thedecrease in tissue percent fat in women administering 3 mg washighest, compared to administering 1 mg of Compound III, andcompared to men administered the same doses.

Performance Effects

In order to analyze the physical performance (which reflects thegain of quality LBM), a stair climb (time and power) study wasconducted. Subjects climbed 12 stairs and data was collected as afunction of time (speed) and power.

Speed: A dose-dependent decrease in the time needed to climb 12stairs was observed with the 3 mg dose of Compound of formulaS-(III) (Compound III) showing a 15.5% decrease in time (p=0.006,ANOVA).

Power Exerted: A dose-dependent increase in power was observed. Insubjects with the 3 mg dose of Compound III, there was 25.5% morepower observed than in the placebo group (p=0.005, ANOVA). Anincrease of 62 watts is approximately 8 times what is consideredclinically significant in a middle-aged to elderly non-athlete.

Thus, Compound III built lean body mass in both men and women andlowered the percent body fat. This lean body mass improvementtranslated to improved performance and power on a stair climb,which indicates, inter alia, that Compound III improves strengthand provides a clinical benefit in the elderly and in persons wherea condition such as cancer or chronic kidney disease has caused ormay cause muscle wasting.

Bone Mass Effects

Bone Mineral Density (BMD) (DEXA): BMD measurements in treatedpatients were not different from baseline or from placebo. This wasnot unexpected since 90 days of dosing and measurement isinsufficient time to observe meaningful changes in BMD. Boneresorption and turnover markers: In preclinical in vitro and invivo models of osteoporosis tested, Compound III demonstrated bothanabolic and antiresorptive activity affecting both the osteoblastsand osteoclasts.

Safety

Adverse Events (AEs) and Severe Adverse Events (SAEs)--

Compound III was shown to be safe and well tolerated. There were notrends in AEs and there were no SAEs reported during 90 day studyperiod.

Hepatic Effects

It is well known that natural anabolic steroids and syntheticanabolic steroids induce elevations in liver transaminases, inparticular ALT and AST. Compound III, in contrast, appeared tominimally affect ALT and AST levels. Of the 120 patients evaluated,1 female patient exhibited an isolated ALT elevation with no otherclinically meaningful changes including no changes in alkalinephosphatase, GTT, and total bilirubin levels. Of the 114 patientsthat completed the trial, there were no clinically meaningfulchanges in ALT, AST, alkaline phosphatase, GGT, or bilirubin levelsat 3 months post-initiation.

Lipid Profile Effects

Circulating cholesterol, LDL, VLDL, triglyceride and HDL levelswere analyzed: High dose testosterone and other anabolic steroidshave the ability to reduce cholesterol and profoundly reduce HDL(60-80%). Compound III reduced total cholesterol, LDL, VLDL, andtriglycerides in a dose-dependent manner. A dose-dependentreduction in HDL was seen, as well, however not of the magnitude ofother orally administered anabolic agents. LDL/HDL ratios, whichare a well established way to identify cardiovascular risk,revealed that Compound III treated subjects and placebo groups werein the low or below cardiovascular risk category at all doses.

Body Weight Effects

All subjects total body weight was measured post-administration ofCompound III. A dose-dependent change in total body weight of allsubjects given a 0.1 mg, 0.3 mg, 1 mg and 3 mg dose of Compound IIIwas observed. Treatment with 0.3 mg or 3 mg Compound III exhibitedan increase of 1 kg compared to placebo (and 0.9 kg, frombaseline), with a p=0.196 and 0.178 respectively, (ANOVA) (Table5).

TABLE-US-00005 TABLE 5 Placebo 0.1 mg 0.3 mg 1 mg 3 mg Baseline68.0 .+-. 72.0 72.5 .+-. 10.6 68.6 .+-. 15.9 72.9 .+-. 13.7 62.5.+-. 13.5 Mean .+-. SD (kg) Mean absolute -0.1 .+-. 2.3 0.4 .+-.1.3 0.9 .+-. 4.9 0.3 .+-. 1.7 0.9 .+-. 1.7 change from baseline.+-. SD (kg) p-value 0.510 0.196 0.550 0.178 (compared to placebo)p-value 0.791 0.504 0.121 0.568 0.105 (compared to baseline) Mean %-0.1 .+-. 3.5 0.5 .+-. 1.8 3.1 .+-. 15.0 0.4 .+-. 2.3 1.7 .+-. 2.7change from baseline .+-. SD

A dose-dependent change in total body weight of women given a 3 mgdose of Compound III was observed, with an increase of 0.8 kgcompared to placebo (and 1.63 kg from baseline; Table 6) with ap=0.279 (ANOVA) and with the 1 mg dose a decrease of 0.9 kgcompared to the placebo with a p=0.215 (ANOVA).

A dose-dependent change in total body weight of men with the 3 mgdose of Compound III was observed, with an increase of 0.7 kgcompared to placebo with a p=0.277 (ANOVA) and with the 1 mg dosean increase of 1 kg compared to the placebo with a p=0.193(ANOVA).

TABLE-US-00006 TABLE 6 Placebo 1 mg 3 mg Females 0.850 .+-. 2.09-0.080 .+-. 1.02 1.63 .+-. 1.10 (kg) 0.215 0.279 Males (kg) -0.375.+-. 1.45 0.655 .+-. 2.18 0.383 .+-. 1.85 0.193 0.277

Hormonal Effects

Testosterone and other anabolic steroid agents suppress LHsecretion by feedback inhibition on the pituitary. Less LH leads tolower endogenously produced testosterone. LH levels (U/L) changedrelative to placebo groups, as a function of treatment withCompound III.

Administration of 0.1 mg to women led to a 1.2.+-.1.14 U/L increase(p=0.01) in LH, and to a 0.8.+-.1.14 U/L decrease (p=0.466) inmen.

Administration of 0.3 mg to women led to a 1.8.+-.1.09 U/L decrease(p=0.403) in LH, and to a 0.1.+-.1.19 U/L increase (p=0.834) inmen.

Administration of 1 mg to women led to a 2.6.+-.1.19 U/L decrease(p=0.780) in LH, and to a 0.7.+-.1.14 U/L decrease (p=0.476) inmen.

Administration of 3 mg to women led to a 6.4.+-.1.14 U/L reduction(p=0.039) in LH, and to a 0.5.+-.1.09 U/L decrease (p=0.543) in men(Table 7).

TABLE-US-00007 TABLE 7 Placebo 0.1 mg 0.3 mg 1 mg 3 mg FEMALESChange in -3.1 .+-. 1.14 1.2 .+-. 1.14 -1.8 .+-. 1.09 -2.6 .+-.1.19 -6.4 .+-. 1.14 LS mean from baseline .+-. SE (U/L) p-value0.010 0.403 0.780 0.039 (compared to from placebo) MALES Change in0.4 .+-. 1.09 -0.8 .+-. 1.14 0.1 .+-. 1.19 -0.7 .+-. 1.14 -0.5 .+-.1.09 LS mean from baseline .+-. SE (U/L) p-value 0.466 0.834 0.4760.543 (compared to from placebo)

SHBG is a sensitive marker of anabolic activity. Anabolic agentslower SHBG levels. In this study, consistent with its anabolicactivity, Compound III exhibited a dose-dependent, profoundreduction of SHBG levels. Administration of 0.1 mg, 0.3 mg, 1 mg or3 mg Compound III resulted in reduction of SHBG levels in men andwomen (Table 8).

TABLE-US-00008 TABLE 8 Placebo 0.1 mg 0.3 mg 1 mg 3 mg FemalesChange in -16.5 .+-. 5.82 -1.1 .+-. 5.82 -21.2 .+-. 5.57 -55.8 .+-.6.11 -52.9 .+-. 5.82 LS mean from baseline .+-. SE (nmol/L) p-value0.064 0.564 <0.001 <0.001 (compared to from placebo) MalesChange in -10.0 .+-. 5.57 -6.1 .+-. 5.82 -12.4 .+-. 6.11 -19.1 .+-.5.82 -25.8 .+-. 5.57 LS mean from baseline .+-. SE (nmol/L) p-value0.627 0.775 0.265 0.048 (compared to from placebo)

Endogenous free testosterone levels decreased relative to placebogroups post-administration of 0.1 mg, 0.3 mg or 1 mg to women, andhad no change relative to placebo post administration of 3 mgCompound III (Table 9).

Free testosterone levels in men increased relative to placebogroups post administration of 0.1 mg, 0.3 or 3 mg of Compound IIIand had almost no change relative to placebo groups postadministration of 1 mg Compound III.

TABLE-US-00009 TABLE 9 Placebo 0.1 mg 0.3 mg 1 mg 3 mg FemalesChange in LS -0.5 .+-. 2.80 -2.0 .+-. 2.99 -1.0 .+-. 2.50 -0.9 .+-.2.64 -0.5 .+-. 3.23 mean from baseline .+-. SE (pmol/L) p-value0.718 0.887 0.922 0.995 (compared to from placebo) Males Change inLS -11.2 .+-. 2.64 0.5 .+-. 2.80 2.7 .+-. 2.80 -11.0 .+-. 2.54 -8.2.+-. 2.50 mean from baseline .+-. SE (pmol/L) p-value 0.003<0.001 0.966 0.413 (compared to from placebo)

A potential side effect of testosterone and other androgenicanabolic steroids is stimulation of the prostate. Measurement ofserum PSA is a sensitive measure of stimulation of the prostategland. Compound III had no effect on serum PSA levels at any dosetested.

Androgenic steroids stimulate sebaceous glands, which play a rolein producing sebum and hair. Compound III did not show anysignificant changes in hair growth in women. Increased sebumproduction can lead to acne and oily skin, an unwanted side effect.Sebum production was measured in both men and women. Compound IIIdid not affect sebum production in men or women compared toplacebo, had no virilization effect and did not cause acne in menand women.

Compound III: a) built lean body mass in both men and women andlowered the percent body fat, b) improved performance and power ona stair climb, thus improving strength and providing a clinicalbenefit in the elderly and in people where a condition such ascancer or chronic kidney disease has caused or may cause musclewasting, c) was minimally androgenic thus diminishing risks ofhirsitism and prostate cancer currently associated withnon-specific androgenic agents, and d) was well tolerated with noserious adverse events reported.

In addition, there were reductions in total cholesterol, LDL andHDL levels. There were no AEs or detrimental changes in othercardiovascular risk factors as measured in the study (such as bloodpressure, insulin sensitivity). The data shows that there is a 20%decline in HDL while LDL, triglycerides and total cholesterol arelowered in the presence of increased muscle and decreased bodyfat.

A 1.5 kg (3.3 lb) improvement in lean body mass is clinicallymeaningful and consistent with what is seen with other anabolicagents. As men lose a 1/2 lb. per year this would representreversing 7 years of muscle loss in 3 months. The lean body massimprovement translates to an improvement in function and musclepower. The improvement was seen in both men and women at the samedose that improved muscle mass. This indicates that if the SARMcompound of formula S-(III) delivers the same lean body massimprovement in the elderly population or those people sufferingfrom conditions which accelerate muscle wasting then it would alsoprovide a functional benefit and improved quality of life.

Example 5

Compound of Formula S-(III)-Mediated Reduction of Glucose andInsulin Levels

Five groups of 24 human subjects per group (12 males and 12females) of 60 elderly men (age >60) and 60 postmenopausal women(not hypogonadal, not osteoporotic, no exercise program, nocontrolled diet) were dosed each in a randomized, double-blindstudy design. Each subject received 0.1 mg, 0.3 mg, 1 mg, and 3 mgCompound of formula S-(III) (Compound III) (or placebo of equalvolume) in solution or in experimental capsules for 90 daystreatment. Glucose and insulin levels were analyzed.

Results

The subjects exhibited dose-dependent decreases in totalcirculating insulin levels post-administration of 0.3 mg, 1 mg or 3mg of Compound III for all subjects (all fasting subjects).Treatment with 3 mg Compound III exhibited decrease in insulinlevels of about 17.6-43.5 pmol/L compared to baseline with ap=0.043 (ANOVA). The 1 mg dose of Compound III exhibited decreaseof 5.43*16.7 pmol/L compared to baseline with a p=0.143 (ANOVA)(Table 10).

TABLE-US-00010 TABLE 10 Placebo 0.1 mg 0.3 mg 1 mg 3 mg Baseline43.3 .+-. 21.3 44.1 .+-. 26.1 38.1 .+-. 26.6 56.6 .+-. 37.1 52.9.+-. 48.5 Mean .+-. SD (pmol/L) Mean absolute -0.32 .+-. 14.5 4.96.+-. 21.0 -1.30 .+-. 19.0 -5.43 .+-. 16.7 -17.6 .+-. 43.5 changefrom baseline .+-. SD (pmol/L) p-value 0.169 0.423 0.143 0.043 Mean% 0.5 .+-. 31.9 19.2 .+-. 49.7 5.9 .+-. 44.2 -6.9 .+-. 24.9 -17.6.+-. 37.0 change from baseline .+-. SD

All subjects (all fasting) exhibited dose-dependent decreases intotal glucose levels post-administration of 0.3 mg, 1 mg or 3 mg ofCompound III. Treatment with 3 mg Compound III exhibited decreasein glucose levels of 11.1.+-.7.4% compared to baseline. The 1 mgdose of Compound III exhibited decrease of 3.5-6.3% compared tobaseline with a p=0.764 (ANOVA) (Table 11).

TABLE-US-00011 TABLE 11 Placebo 0.1 mg 0.3 mg 1 mg 3 mg Baseline5.09 .+-. 0.44 5.17 .+-. 0.50 4.85 .+-. 0.41 5.29 .+-. 0.39 5.22.+-. 0.51 Mean .+-. SD mmol/L Mean absolute -0.19 .+-. 0.35 0.2.+-. 0.42 -0.01 .+-. 0.42 -0.19 .+-. 0.33 -0.60 .+-. 0.44 changefrom baseline .+-. SD Mmol/L p-value 0.039 0.064 0.481 <0.001Mean % -3.5 .+-. 6.5 0.7 .+-. 8.2 0.3 .+-. 9.9 -3.5 .+-. 6.3 -11.1.+-. 7.4 change from baseline .+-. SD

Females exhibited a dose-dependent decrease in total glucose levelspost-administration of 1 mg or 3 mg of Compound III, with the 1 mgdose achieving p=0.343 (ANOVA) and the 3 mg achieving p=0.012(ANOVA). Males exhibited a dose-dependent decrease in total glucoselevels post-administration of 1 mg or 3 mg doses of Compound III,with the 1 mg dose achieving p=0.998 (ANOVA) and the 3 mg doseachieving p=0.247 (ANOVA) (Table 12).

TABLE-US-00012 TABLE 12 Placebo 1 mg 3 mg All subjects -1.4 .+-.5.2 -2.5 .+-. 6.2 -8.6 .+-. 9.1 Absolute change from (mg/dL)(mg/dL) (mg/dL) baseline 0.470 0.004 Females -1.2 .+-. 5.6 -4.5.+-. 7.5 -11.4 .+-. 10.0 Absolute change from (mg/dL) (mg/dL)(mg/dL) baseline 0.343 0.012 Males -1.5 .+-. 5.0 -1.6 .+-. 5.6 -4.9.+-. 6.7 Absolute change from (mg/dL) (mg/dL) (mg/dL) baseline0.998 0.247

The decrease in the concentration of glucose in women,post-administration of Compound III was twice as high as that inmen.

Example 6

Compound of Formula S-(III)-Mediated Reduction of InsulinResistance (HOMA-IR)

Five groups of 24 human subjects per group (12 males and 12females) of 60 elderly men (age >60) and 60 postmenopausal women(not hypogonadal, not osteoporotic, no exercise program, nocontrolled diet) were dosed each in a randomized, double-blindstudy design. Each subject received 0.1 mg, 0.3 mg, 1 mg, and 3 mgCompound of formula S-(III) (Compound III) (or placebo of equalvolume) in solution or in experimental capsules for 90 daystreatment. Insulin resistance was analyzed, calculated from themean fasting glucose and insulin levels.

Results

The subjects (all fasting subjects) exhibited dose-dependentdecreases in insulin resistance levels post-administration of 0.3mg, 1 mg or 3 mg of Compound III for all subjects after 86 days.Treatment with 3 mg Compound III exhibited decrease in insulinresistance levels of about 27% compared to baseline (Table 13).

TABLE-US-00013 TABLE 13 Placebo 0.1 mg 0.3 mg 1 mg 3 mg Baseline1.42 .+-. 0.73 1.51 .+-. 1.04 1.16 .+-. 0.70 1.96 .+-. 1.47 1.84.+-. 1.97 Mean .+-. SD Mean -0.06 .+-. 0.50 0.18 .+-. 0.78 -0.01.+-. 0.51 -0.24 .+-. 0.60 -0.79 .+-. 1.80 absolute change frombaseline .+-. SD p-value 0.112 0.364 0.145 0.037 Mean % -2.7 .+-.32.5 21.3 .+-. 52.9 6.9 .+-. 48.0 -10.1 .+-. 25.6 -26.8 .+-. 33.4change from baseline .+-. SD

The levels of fasting plasma glucose (FPG), insulin and homeostasisinsulin resistance (HOMA-IR) following administration ofAvandia.RTM., glipizide and Compound III exhibited the highest mean% changes from baseline with Compound III. Compound III exhibited-40% mean change from baseline of HOMA-IR, -30% mean change frombaseline of insulin and -17% mean change from baseline of FPG, aspresented in FIG. 10.

Example 7

Compound of Formula S-(III) Improves Soleus Strength in Rats

Materials and Methods

Female Sprague Dawley rats were divided into three groups,representing sham (vehicle) treated, ovariectomized (OVX), shamtreated, and OVX animals receiving 3 mg/day Compound of formulaS-(III) (Compound III). Compound III and vehicle were administeredonce daily by oral gavage. After 42 consecutive days of dosing,animals were sacrificed, the left hind limb soleus muscle wasdissected and tested for strength analysis. The ratio betweenP.sub.0, the peak titanic tension (N), and CSA, the cross sectionalarea (cm.sup.2), was determined.

Results

Female rats exhibited improvement in soleus strength. Sham treatedand ovariectomized (OVX) sham treated animals exhibited a strengthof about 30 N/cm.sup.2, while OVX-Compound III treated animalsexhibited a strength of about 40 N/cm.sup.2. Results are presentedgraphically in FIG. 11.

Example 8

SARM Bone Effects Alone and in Combination with the Anti-ResorptiveAgent, Alendronate

Materials and Methods

Sixty female, virgin, intact Sprague-Dawley rats were obtained fromCharles River Laboratories (Wilmington, Mass.) and aged to 23 wks.The animals were housed 2-3 per cage and acclimated to a 12-hlight/dark cycle. Food (7012C LM-485 Mouse/Rat Sterilizable Diet,Harlan Teklad, Madison, Wis.) and water were provided ad libitum.The Institutional Animal Care and Use Committee of the Universityof Tennessee reviewed and approved the animal protocol for thisstudy.

Sham surgeries or ovariectomies were performed on Day 0. The studywas comprised of eight treatment groups as follows: (1)intact+vehicle, (2) intact+Compound III, (3) OVX+vehicle (4)OVX+Compound III, (5) OVX+DHT, (6) OVX+E2, (7) OVX+alendronate, (8)OVX+alendronate+Compound III. Doses were administered daily viaoral gavage in a vehicle of DMSO:PEG300 (10:90) beginning on Day 1.Animals were sacrificed on Day 45 of the study. Femurs wereremoved, cleared of soft tissue, and stored in saline soaked gauzeat -20.degree. C. until analysis. Nine animals died during thecourse of the study. These deaths were attributed to surgicalcomplications arising from the ovariectomies and technical errorsduring oral dosing (i.e., dosing solution delivered into thelungs). Dose groups are listed in the Table 14:

TABLE-US-00014 TABLE 14 Gonadal Group Status Treatment DoseAnimals/group 1 Intact Vehicle N/A 9 2 Intact COMPOUND III 3 mg/day9 3 OVX Vehicle N/A 7 4 OVX COMPOUND III 3 mg/day 8 5 OVXAlendronate 1 mg/day 10 6 OVX Alendronate/ 1 and 3 mg/day 8COMPOUND III

The left femurs were sent to SkeleTech Inc. (Bothell, Wash.) forbiomechanical strength (three point bending) and pQCT analysis. AStratec XCT RM and associated software (Stratec MedizintechnikGmbH, Pforzheim, Germany. Software version 5.40 C) were used forthe pQCT analysis. The femur was analyzed at both the mid-shaft anddistal regions. The mid-shaft analysis was performed on the regionat 50% of the length of the femur. The distal analysis wasperformed on the region at 20% of the length of the femur startingat the distal end. One 0.5 mm slice perpendicular to the long axisof the femur was used for analysis. Total bone mineral content,total bone area, total bone mineral density, cortical bone mineralcontent, cortical bone area, cortical bone mineral density,cortical thickness, periosteal perimeter (circumference) andendosteal perimeter were determined at the mid-shaft of the femur.At the distal femur, total bone mineral content, total bone area,total bone mineral density, trabecular bone mineral content,trabecular bone area and trabecular bone mineral density weredetermined. Following pQCT analysis, the femoral strength wasdetermined by a three-point bending test. The anterior to posteriordiameter (APD) (unit: mm) at the midpoint of the femoral shaft wasmeasured with an electronic caliper. The femr was placed on thelower supports of a three-point bending fixture with the anteriorside of the femur facing downward in an Instron Mechanical TestingMachine (Instron 4465 retrofitted to 5500)(Canton, Mass.). Thelength (L) between the lower supports was set to 14 mm. The upperloading device was aligned to the center of the femoral shaft. Theload was applied at a constant displacement rate of 6 mm/min untilthe femur broke. The mechanical testing machine directly measuredthe maximum bad (F.sub.u) (unit: N), stiffness (S) (units: N/nm),and energy absorbed (W) (unit: mJ). The axial area moment ofinertia (I) (unit: mm.sup.4) was calculated by the software duringthe pQCT analysis of the femoral mid-shaft. Stress (.sigma.)(units: N/mm.sup.2), elastic modulus (E) (unit: Mpa), and toughness(T) (units: mJ/m.sup.3) were calculated by the following formulas:stress: .sigma.=(F.sub.u*L*(a/2))/(4*I); elastic modulus:E=S*L.sup.3/(48*I); and toughness: T=3*W*(APD/2).sup.2/(L*I).

Statistical analysis was performed by Student's T-test. P-values ofless than 0.05 were considered as statistically significantdifferences.

Male rats were subjected to orchidectomy (ORX), and on days 1-119were administered peroally by gavage a vehicle, different doses ofCompound III (0.1, 1, and 3 mg/d), with or without alendronate (1mg/d), and alendronate alone. After sacrifice at the indicatedtimes, mice were sacrificed, femurs removed and subjected to pQCTanalysis and a 3-point bending assay. Vertebra were harvested aswell, and crush assay of LS was conducted. Tibias were subjected tostatic and dynamic histomorphometry (calcein).

Results

Trabecular bone mineral density was analyzed by pQCT at the distalfemur. Results are shown in FIG. 12A. Significant trabecular boneloss was observed following OVX. Trabecular bone density decreasedfrom 379 to 215 mg/mm.sup.3 in the intact and OVX vehicle controlgroups, respectively. In intact animals treated with Compound III,a slight increase in trabecular bone density to 398 mg/mm.sup.3 wasobserved. In OVX animals treated with Compound III, a significantincrease was observed over the OVX vehicle control group to 406mg/mm.sup.3. DHT increased trabecular bone density over the OVXvehicle control group to 360 mg/mm.sup.3 and estradiol (E2)increased trabecular bone density to 415 mg/mm.sup.3. Alendronateincreased trabecular bone density to 480 mg/mm.sup.3. Thecombination therapy of alendronate and Compound III showed additiveeffects increasing trabecular bone density to 552 mg/mm.sup.3.

Rat distal femur representative reconstructions were prepared bystandard methodology. As seen in FIG. 12B, while OVX animals showpronounced loss of normal architecture (panel B), OVX CompoundIII-treated animals provided a structure comparable to intactcontrols (panel D).

Ovariectomized animals may serve as a model for females sufferingfrom ADIF, and as such, one embodiment of this invention istreatment thereof, for example, via administration of Compound IIIas exemplified herein.

As evident from FIGS. 12C (BV/TV) and 12D (trabecular number),Compound III prevented gonadectomy-induced losses in trabecularbone in males, as well.

Example 9

Pharmaco*kinetics of Compound of Formula S-(III)

In order to determine the pharmaco*kinetics of Compound of formulaS-(III) (Compound III), the compound was administered to beagledogs perorally, and circulating plasma levels, C.sub.max,t.sub.max, t.sub.1/2, AUC and F % (FIG. 13 and the Table 15 below,respectively) were determined. Compound III was rapidly andcompletely absorbed.

TABLE-US-00015 TABLE 15 Male Female Male Female 1 mg/kg 1 mg/kg 1mg/kg 1 mg/kg Soln. Soln. Cap. Cap. C.sub.max 0.91 .+-. 0.1 0.56.+-. 0.26 0.59 .+-. 0.16 0.58 .+-. 0.06 (mg/mL) t.sub.max 250 .+-.161 165 .+-. 211 120 .+-. 37 250 .+-. 313 (min) t.sub.1/2 (hr) 24.335.5 21.0 35.5 AUC 1.96 .+-. 0.72 1.66 .+-. 0.70 1.22 .+-. 0.341.71 .+-. 0.43 min * mg/mL F % 104% 73.5% 64.8% 75.6%

Example 10

Mapping of AR Binding Sites

Materials and Methods

Reagents

AR and SHC-1 antibodies were obtained from Upstate Biotechnology(Lake Placid, N.Y.), SRC-1 antibody was obtained from SantacruzBiotechnology (Santa Cruz, Calif.). Protein A Sepharose wasobtained from Amersham Pharmacia (Piscataway, N.J.). WTS reagentwas purchased from Roche (Nutley, N.J.). All cell culture mediumwas obtained from Invitrogen (Carlsbad, Calif.) and the serum forcell culture obtained from Atlanta Biologicals (Atlanta, Ga.). Allother reagents used were analytical grade.

Cell Culture

LNCaP, prostate cancer cells, were obtained from ATCC (Manassas,Va.). The cells were grown in RPMI 1640 (containing 2 mML-glutamine, 10 mM HEPES, 1 mM sodium pyruvate, penicillin andstreptomycin) supplemented with 10% fetal bovine serum (FBS). Forthe ChIP assays, cells were plated in 150 mm dishes at 10 millioncells per dish in RPMI 1640 supplemented with 1% charcoal strippedFBS. The cells were maintained in 1% csFBS for 6 days to reducebasal occupancy of promoters with medium changed on days 1 and 3and before treatment on day 6.

Chromatin Immunoprecipitation Assay (ChIP)

ChIP assays were perfumed as described earlier (Narayanan, R. etal., 2005). The proteins were cross-linked by incubation with 1%formaldehyde (final concentration) at 37.degree. C. for 10 min. Thecells were washed with 1.times.PBS twice, scraped in 1 ml of PBScontaining protease inhibitors ([1 mg each of aprotinin, leupeptin,antipain, benzamidine HCl, and pepstatin/ml], 0.2 mMphenylmethylsulfonyl fluoride, and 1 mM sodium vanadate), pelleted,and resuspended in SDS lysis buffer (1% SDS, 10 mM EDTA, 5 mMTris-HC [pH 8.1]). After lysis on ice for 10 min, the cell extractwas sonicated (Branson sonifer 250) in a cold mom eight times for10 s each at constant duty cycle, with an output of 3 and withincubation on ice after every sonication. The debris was pelletedat 13,000 rpm for 10 min at 4.degree. C., and the supernatant wasdiluted 10-fold with ChIP dilution buffer (0.01% SDS, 1.1% TritonX-100, 1.2 mM EDTA, 16.7 mM Tris HQ [pH 8.1], 167 mM NaCl). Theproteins were precleared with 50 .mu.l of 1:1 protein A-Sepharosebeads in TE, 300 .mu.l was reserved as input, and the remaining wasincubated with 5 .mu.g of AR or SRC-1 antibody or IgG (negativecontrol) and 2 .mu.g of sheared salmon sperm DNA (Stratagene, LaJolla, Calif.) rotating to overnight at 4.degree. C. Theprotein-DNA-antibody complex was precipitated by incubating with100 .mu.l of 1:1 protein A-Sepharose beads and 2 .mu.g of salmonsperm DNA at 4.degree. C. for 2 h. The beads were pelleted andwashed three times with low-salt wash buffer (0.1% sodium dodecylsulfate [SDS], 1% Triton X-100, 2 mM EDTA, 20 mM Tris HCl [pH 8.1],0.15 M NaCl), and twice with 1.times.TE (10 mM Tris HCl, 1 mM EDTA;pH 8.0). The DNA-protein complex was obtained by extracting thebeads with 50 .mu.l of freshly prepared extraction buffer (1% SDS,0.1 M NaHCO.sub.3) three times. The cross-linking of the DNAprotein complex was reversed by incubating at 65.degree. C. for 6h. The DNA was extracted with a QIAquick PCR purification kit(QIAGEN, Valencia, Calif.) in 25 .mu.l final volume of TE.

Real-Time PCR

The realtime PCR was performed on an ABI 7300 (Applied Biosystems)using TaqMan PCR master mix at universal condition. The numbers onthe y axis of the ChIP assay results were obtained by dividing thearbitrary quantitative PCR numbers obtained for each sample by therespective input. All promoter array results were validated usingprimers and taqman probes (Biocource, CO) given in the followingTable 16.

TABLE-US-00016 TABLE 16 Realtime PCR primers for ChIP assay SEQ. IDPrimer Name Sequence No. MSX-1 Forward Primer AACCCAGCCACAGACTAAAGA1 MSX-1 Reverse Primer TCCCTTGTTCTCGTTCCTC 2 MSX-1 Taqman PrimerAAAGAGGAGCGGAAAAGAGGGCTG 3 APIG1 Forward PrimerGGGTCCGAGTTCTTGGATAA 4 APIG1 Reverse Primer ATCCTGAGGAAGGAGGGAT 5APIG1 Taqman Primer GGACAGGGAGCGAAGTTTCCTCAA 6 AXIN-1 ForwardPrimer ATTCCAAGGACCTGCAACG 7 AXIN-1 Reverse PrimerGAGAGGGCGTGGTCAGTG 8 AXIN-1 Taqman Primer CGCCTCTCCCACTCCGCTCT 9BATF-1 Forward Primer CTGGACTTAAGGGGTGAGGA 10 BATF-1 Reverse PrimerGGAGAGGACAACCAGGAAAA 11 BATF-1 Taqman Primer TGAGCAGCTGCTTTCGGCTGAA12 SHC-1 Forward Primer TAACTCGGGAAAGTGGGAAG 13 SHC-1 ReversePrimer AGCTTAGGTTACCGCTCCAA 14 SHC-1 Taqman PrimerAATAAAGTTTCTCCAGGGAGGCAGGG 15 NFkB1 Forward PrimerCTCGAGAGAGTATGGACCGCATGACTCTATCA 16 NFkB1 Reverse PrimerACGCGTAGAGAGAGCATACAGACAGACGGACA 17 PCBP2 Forward PrimerAGATGATGGGAGGTTTGGAG 18 PCBP2 Reverse Primer GCCTAAACCAGAAACCAAGG19 PCBP2 Taqman Primer ATTTGGGGTAAGGGAGGTGAAGGAGG 20 PSA ForwardPrimer GCCTGGATCTGAGAGAGATATCTC 21 PSA Reverse PrimerACACCTTTTTTTTTGGATTGTTG 22 PSA Taqman PrimerTGCAAGGATGCCTGCTTTACAAACATCC 23

Promoter Array

H20K promoter array from AVIVA systems biology (San Diego, Calif.)was used for these experiments. The array consists of 20,000 probepairs mapped to about 19,600 unique proximal promoter regions.Proximal promoter regions between -1.0 KB to +300 bp were spottedon this array. Before hybridization, the efficiency of the ChIPassay was tested on PSA enhancer using quantitative PCR.Manufacturer's protocol was followed for the hybidization using Cy5label for the immunoprecipitated samples and Cy3 label for totalinput DNA. The hybridized slides were scanned using a Gene Pix 4scanner. Resulting background subtracted median intensities forboth the Cy3 and the Cy5 channels were used to calculate normalizedlog.sub.2 (Cy5/Cy3) or M values in the limmaGUI.sup.42 packagedeveloped for the R statistical language. In limmaGUI, backgroundsubtraction was set to minimum replacing confounding negative orzero intensities with very small positive numbers. Default settingswere used for spot quality weighting and all arrays werewithin-array normalized using the global-loss function andbetween-array normalized using the aquantile method as needed. Aone-tailed students t-test was used to determine significance(P<0.05) of treatment hybridization versus vehicle control wherethe mean of replicate normalized M-values was greater in treatmentthan in control.

Gene Ontology (GO) Functional Analyses

The software package ErmineJ.sup.43 was used to mine statisticallyoverrepresented GO terms from each experimental group andsuccessfully mapped 80% of array targets to their GO annotation. Animplementation of the receiver operator characteristic (ROC) methodwas used in ranking--log(p-values) (NLP) of all genes showingrecruitment and performing the wilcoxon rank sum test to examinesignificance of gene sets (minimum size 20) associated with GOterms containing a greater number of high ranking genes than wouldbe expected if rankings were randomly distributed amongst all genesets. Only the most significant NLP of replicates within each arraywere considered, p<0.05 (uncorrected for multiple comparisons)were reported. Gene product: Go term associations used wereretrieved using SOUCE and the GO database (Ashburner, M. et al.2000)

Orthlogous Promoter Determination and Retrieval

All human-mouse orthologs were determined using NCBI'shom*ologene.sup.41. Using only orthologous Reference Sequences(RefSeq), 5000 base pairs upstream of the transcription start site(TSS) and 2000 base pairs down stream were retrieved using UCSC'sGenome Browser (H. Sapiens and M. musculus NCBI Build 35). 50-60%(712 genes) of the genes of interest contained the completeannotation described and were searched.

Animal Experiments

Rive male Sprague Dawley rats per group (300 g) from Harlan(Indianapolis, Ind.) were housed with three animals per cage andwere allowed free access to tap water and commercial rat chow(Harlan Teklad 22/5 rodent diet--8640). During the course of thestudy, the animals were maintained on a 12 hr light:dark cycle.This study was reviewed and approved by the InstitutionalLaboratory Care and Use Committee of The University of Tennessee.The animals were dosed daily for 15 days with 3 mg/day of SARM orDHT or vehicle (Polyethylene Glycol). Dosing solutions wereprepared daily by dissolving drug in dimethyl sulfoxide (DMSO) anddiluting in polyethylene glycol 300 (PEG 300). At the end of 15days, the animals were sacrificed and the weights of prostate andlevator an measured.

Bone Marrow Culture

Cell culture materials were obtained from Invitrogen (Carlsbad,Calif.). The femurs were first rinsed in 70% ethanol and were thenwashed three times with 5 ml each of penicillin and streptomycin.Both ends of the femurs were snapped and the bone marrow cells wereflushed with 15 mil of MEM with penicillin, streptomycin andfungizone into a 50 ml conical tube and stored on ice. The bonemarrow cells were pooled and were centrifuged at 1000 rpm for 5 minin a clinical centrifuge. The cells were resuspended in phenolred-free MEM supplemented with 10% charcoal-stripped serum,penicillin, streptomycin and fungizone. The cells were trituratedthough a 22 g needle, counted under microscope, and were plated at1.5 million cells per well of a 6 well plate in phenol red-free MEMsupplemented with 15% charcoal-stripped serum, penicillin,streptomycin, 300 ng/ml fungizone, 0.28 mM ascorbic acid, and 10 mM.beta.-glycerophosphate to differentiate towards thefibroblast/osteoblast lineage. In separate wells, 2.5 million cellsper well were plated in 24 well plates in phenol red-free MEMsupplemented with 10% charcoal stripped serum, penicillin,streptomycin, and 300 ng/ml fungizone to differentiate towards theosteoclast lineage. The medium was changed on day 2 and the cellswere treated with the compound of interest. Osteoclast cultureswere performed in the presence of RANK Ligand (50 ng) and GM-CSF(10 ng) to induce osteoclastogenesis. Medium was completely changedevery third day for osteoclast cultures. For fibroblast cultures,half the culture medium was changed every third day to leave thegrowth factors secreted by the cells.

Staining of Cells

At the end of 12 days, the cells were fixed in 10% bufferedformalin for fibroblast cultures and in 4% formaldehyde in PBS forosteoclast cultures. The fibroblasts were stained for alkalinephosphatase activity and the O.D. at 405 nm was measured using aspectrophotometer as described earlier. The osteoclasts werestained for Tartarate Resistant Acid Phosphatase Activity (TRAP)and cells having 2 or more nuclei were counted under themicroscope.

RNA Analysis and Reverse Transcriptase Polymerase ChainReaction

LNCaP cells were plated at 700,000 cells per well of a 6 well platein RPMI supplemented with 1% csFBS or in full serum. The cells weremaintained for 3 days and were treated with vehicle, DHT or SARM.RNA was isolated using Trizol (Invitrogen) and the expression ofvarious genes measured using TaqMan prime probe mix from AppliedBiosystems using one step rtPCR master mix on an ABI 7300 realtimePCR machine. The expression of individual gene is normalized to 18SrRNA levels.

Growth Assay

LNCaP cells were plated at 10,000 cells per well of a 96 well platein RPMI supplemented with 1% csFBS. The cells were treated for 72hrs with the indicated concentrations of DHT or SARM. The cellviability at the end of 72 hrs measured using WTS assayreagent.

Co-Immunoprecipitation

LNCaP cells were plated at 4 million cells per 10 cm dish in RPMIsupplemented with 1% csFBS. The cells were maintained in 19% csFBScontaining medium for 2 days. The medium was changed and weretreated with vehicle, 100 nM DHT or SARM for 1 hr. Protein wasextracted in hom*ogenization buffer (0.05 M potassium phosphate, 10mM sodium molybdate, 50 mM sodium fluoride, 2 mM EDTA, 2 mM EGTA,and 0.05% monothioglycerol [pH 7.4] containing 0.4 M NaCl and theprotease inhibitors mentioned above) by three freeze thaw cycles indry ice ethanol bath. Equal amounts of protein (100 .mu.g) wereimmunoprecipitated with SHC-1 antibody or IgG over nigh rotating at4.degree. C. The protein antibody complex was precipitated by theaddition of protein A sepharose for 2 hrs. The beads were pelletedand washed three times with low salt wash buffer and twice with TE.The proteins were extracted from the beads by boiling for 10 minwith 2.times. Laemmli buffer. The protein extracts werefractionated on a 6.5% SDS-PAGE, transferred to a nitrocelluloseand western blotted with SRC-1 antibody.

Results

Mapping of AR Binding Sites in Response to DHT and SARM

A chromatin immunoprecipitation assay (ChIP) assay was coupled withDNA microarray to determine the genome wide-binding of AR tovarious proximal promoter regions. LNCaP cells were treated withDHT or SARM, and equal amounts of DNA were hybridized to thetranscription factor promoter array. AR significantly associatedwith 1303 of the promoter regions for known protein-coding genes inthe presence of DHT or SARM (FIG. 14A). AR bound to nearly 6.5% ofthe promoters spotted on the array. Although DHT and SARMstimulated the recruitment of AR to a similar number of genepromoters, only 118 of the 1303 promoters were shared. In responseto DHT, 626 promoters were uniquely occupied, while in response toSARM, 559 promoters were uniquely occupied by AR. Functionalanalysis of the genes revealed profound differences in thefunctional activity of these genes (FIG. 14B). DHT promotedrecruitment of the AR to 71% and 63% of the genes associated withcell growth and extracellular matrix, respectively, while only 29%and 31%, respectively of these promoters were occupied by the AR inresponse to SARM. In contrast, SARM stimulated recruitment of theAR to 63% of the genes associated with an external stimulus (eg.intracellular signaling pathways). Genes associated withcytoskeleton, reproduction, development, transcription andmetabolism were associated about equally with DHT and SARMtreatment. A comparative genomics search was used to identify thepresence of AREs in the 1303 gene promoters. Totally 712 of the1303 gene promoters were sufficiently annotated in the human andmouse database for this search. 78 of 350 searched promotersrecruiting AR in response to DHT contained AREs, whereas 69 of 277SARM-responsive promoters were classified as ARE positive (FIG.14C).

Mapping of SRC-1 Binding Sites in Response to DHT and SARM

SRC-1 was efficiently recruited in the presence of DHT and SARM(FIG. 15A). Using promoter array and identical conditions to thatused for AR, we mapped SRC-1 binding to 285 promoters (FIG. 15B).DHT recruited SRC-1 to 498 promoters, SARM recruited SRC-1 to 640promoters and DHT or SARM commonly recruited SRC-1 to 147promoters. Functional analysis of the genes revealed somesignificant differences in the functional activity of these genes(FIG. 15C). DHT promoted recruitment of SRC-1 to 67% and 28% of thegenes associated with reproduction and cytoskeleton, respectively,while 33% and 55%, respectively of the promoters were occupied bySRC-1 in response to SARM. Genes associated with other classes wereassociated equally with DHT and SARM. A comparative genomics searchsimilar to that performed with AR was performed with the list ofpromoters occupied by SRC-1 to identify the presence of AREs. FIG.15D shows that 77 of the 269 searched promoters recruiting SRC-1 inresponse to DHT contained AREs, whereas 66 of 317 SARM-responsivepromoters were classified as ARE positive. Array results werevalidated by performing realtime PCR on the DNA pool obtained fromChIP experiments in LNCaP cells using SRC-1 antibody.

The tissue selective responses of the compounds of this inventionmay be a result of their interaction with a particular androgenreceptor subtype, as a function of tissue expression, or in someembodiments, as a function of tissue distribution of the particularcompound, or tissue distribution of a metabolite thereof, or afunction of the interaction of the compound with a5.alpha.-reductase, or by any other mechanism.

In some embodiment, tissue selectivity is a function of the ligandaffinity, or in some embodiments, intrinsic activity of thecompound, for example, in terms of the ligand-induced receptorconformational change. In some embodiments, the tissue selectivityis a function of the efficacy of the compound in provoking aresponse in terms of effects on gene expression, regulatorrecruitment, interactions with components of the transcriptionalmachinery, or others.

In this context, Compound III has been shown herein to bind theandrogen receptor (K.sub.i=10.5 nM), as well as the serotonintransporter (K.sub.i=2.55 .mu.M).

Validation of Promoter Array

To validate the array results, ChIP assays were performed in LNCaPcells with primers flanking the promoters of representative genesto which the AR was recruited in the presence of DHT (MSX-1), DHTand SARM (APIG1, AXIN1) or SARM (NFkB1E). FIG. 16A shows successfulvalidation of the array results.

Androgen receptor (AR) is known to be involved in both geneactivation and repression. As such, the transcriptional status ofgenes was examined to which AR was recruited. RNA from LNCaP cellstreated with vehicle, DHT or SARM were quantified using rtPCR. FIG.16B shows the transcription of several (SHC-1, MSX-1, AXIN1, NFkB1Eand GAS7).

Example 11

Effect of Compound of Formula S-(III) on Muscle Wasting andPhysical Function in Patients with Cancer

Materials and Methods

Eligible patients were men aged >45 years and postmenopausalwomen who were non-obese, defined as a body mass index (BMI).ltoreq.35 kg/m.sup.2. Additional inclusion criteria included 22%weight loss in the 6 months before screening, life expectancy >6months, and an Eastern Cooperative Oncology Group (ECOG) score of.ltoreq.1. Patients must have been diagnosed with non-small celllung cancer (Stage 2, 3, or 4), colorectal cancer (Stage 2, 3, or4), non-Hodgkin lymphoma, chronic lymphocytic leukemia, or breastcancer (Stage 3 or 4), and had not yet begun chemotherapy or werebetween chemotherapy cycles. Key exclusion criteria included ahistory of active/uncontrolled congestive heart failure,hypertension, chronic hepatitis, hepatic cirrhosis, or infectionwith human immunodeficiency virus or hepatitis A, B, or C. Patientswith aspartate aminotransferase/alanine aminotransferase (ALT)levels >3.times. the upper limit of normal (ULN) or totalbilirubin levels >2 mg/dL were excluded. Patients currentlytaking testosterone, oxandrolone, or testosterone-like agents(e.g., dehydroepiandrosterone, androstenedione and other androgeniccompounds, including herbals) within the past 30 days (or 6 monthsif long-term depot), megestrol acetate, dronabinol, or anyprescription medication intended to increase appetite or treatunintended weight loss were also excluded.

Study Design

A randomized, double-blind, placebo-controlled, multicenterefficacy and safety study of Compound of formula S-(III) (CompoundIII) in patients with cancer was conducted. Eligible patients wererandomized in a 1:1:1 ratio to receive Compound III 1 or 3 mg ormatching placebo orally once daily for up to 113 days.Randomization was stratified to balance the treatment groups bycancer diagnosis.

Results

Patient Disposition and Demographics

A total of 159 patients were randomized and received .gtoreq.1 doseof study drug (placebo, n=52; Compound III 1 mg, n=53; or CompoundIII 3 mg, n=54). Among these patients in the intent-to-treat(ITT)/safety population (N=159), 53 discontinued treatment. Themost common reason for discontinuation was the occurrence of an AE(n=18; 11.3%). There were no significant between-group differencesin the rate of or reasons for discontinuation. The percentage ofpatients who had an on-study DXA scan and were included in themodified ITT (MITT) population (n=114) was similar between theplacebo (73.1%) and Compound III 3-mg (75.9%) groups, but wasslightly lower in the Compound III 1-mg group (66.0%). Baselinedemographic and clinical characteristics were generally similaracross treatment groups (Table 17). Among patients in the safetypopulation, mean age was 65.9 years and the majority of patientswere male (64.8%) and Caucasian (89.9%). At baseline, mean weightloss in the 6 months before screening was substantial (.about.9%)in all treatment groups. In both the safety and MITT populations,there were no statistically significant differences from placebo inthe percentage of weight loss in the previous 6 months, total LBM,or hand grip strength in Compound III 1- or 3-mg treatment groups(Table 17).

TABLE-US-00017 TABLE 17 Patient Demographic and ClinicalCharacteristics Compound III Compound III Placebo 1 mg 3 mg SafetyMITT Safety MITT Safety MITT Characteristic (n = 52) (n = 38) (n =53) (n = 35) (n = 54) (n = 41) Mean age, y 66 (41-83) 65 (41-83) 66(43-87) 65 (43-87) 66 (39-82) 68 (39-- 81) (range) Sex, n (%) Men35 (67) 25 (66) 34 (64) 19 (54) 34 (63) 24 (58) Women 17 (33) 13(34) 19 (36) 16 (46) 20 (37) 17 (42) Race, n (%) Caucasian 47(90.4) 34 (89.5) 45 (84.9) 29 (82.9) 51 (94.4) 38 (92.7) Other 5(9.6) 4 (10.5) 8 (15.1) 6 (17.1) 3 (5.6) 3 (7.3) Cancer type, n (%)NSCLC 21 (40.4) 12 (31.6) 21 (39.6) 9 (25.7) 19 (35.2) 15 (36.6)Colorectal 21 (40.4) 17 (44.7) 21 (39.6) 19 (54.3) 20 (37.0) 13(31.7) Other.sup.a 10 (19.2) 9 (23.7) 11 (20.8) 7 (20.0) 15 (27.8)13 (31.7) Mean (SD) weight -8.7 (5.0) nd -8.9 (4.8) nd -9.0 (5.7)nd change, % Mean (SD) BMI, 24.1 (4.6) 24.5 (5.0) 23.5 (4.8) 23.5(4.6) 24.0 (3.9) 23.7- (3.9) kg/m.sup.2 Mean (SD) LBM, kg 47.0(10.4) 46.9 (10.8) 42.8 (9.1) 42.5 (9.1) 45.3 (9.4) 45.6 (9.6) Mean(SD) stair climb 85.3 (30.5) 85.7 (30.8) 69.4 (34.6) 69.1 (35.1)82.6 (37.9) 78.0 (3- 3.3) power, watts (stairs 1-12) Mean (SD) grip29.0 (11.3) 29.1 (11.7) 26.7 (15.2) 26.4 (15.4) 29.1 (16.2)- 29.5(17.9) strength, kg Abbreviations: BMI, body mass index; LBM, leanbody mass; MITT, modified intent-to-treat; NSCLC, non-small celllung cancer; nd, not determined. .sup.aIncludes non-Hodgkin'slymphoma, chronic lymphocytic leukemia, and breast cancer.

Efficacy

There was a statistically significant increase from baseline to Day113/EOS in total LBM in patients who received Compound III 1 mg(P<0.001) and Compound III 3 mg (P=0.046), but not in those whor*ceived placebo (Table 18). The difference between the CompoundIII 3-mg group and the placebo group was statistically significant(mean change, P=0.041; percentage change, P=0.023). Patients whor*ceived Compound III 1 rag also had an increase in total LBMcompared with patients receiving placebo, although this differencewas not statistically significant. In addition to the pre-specifiedlocal reads of DXA scans, a post hoc analysis of the DXA scans wasalso conducted by a central radiology group. These results wereconsistent with those of the primary local read (data notshown).

TABLE-US-00018 TABLE 18 Change in Total Lean Body Mass: MITTPopulation Compound Compound P value* III III Placebo vs Placebo 1mg 3 mg Compound III (n = 38) (n = 35) (n = 41) 1 mg 3 mg Change toDay 113/EOS N 34 32 34 Mean, g 106.9 1492.4 1274.3 0.066 0.041 SD2674.0 2734.4 3477.6 P value.sup..dagger. 0.879 0.001 0.046Percentage change to Day 113/EOS N 34 32 34 Mean, % 0.29 3.61 2.820.053 0.023 SD 5.80 6.53 7.18 Abbreviations: EOS, end of study;MITT, modified intent-to-treat. *P values are from an ExactWilcoxon rank-sum test with cancer type as the strata, except foranalyses within a single cancer diagnosis. .sup..dagger.P valuesare from an Exact Wilcoxon signed rank test.

In the MIT population, an increase (.about.1 kg) in scale weightwas observed by Day 113/EOS in all treatment groups (1.2%.+-.1.5%change from baseline). Compared with placebo, patients who receivedCompound III 1 or 3 mg had numerically greater gains in scaleweight from baseline to Day 29 (0.59 and 0.88 kg, respectively, vs0.49 kg) and Day 57 (1.17 and 1.31 kg, respectively, vs 0.5 kg).These data are consistent with the changes seen in total LBM inthese treatment groups.

There was a significant increase from baseline to Day 113/EOS instair climb power among patients who received Compound III 1 or 3mg (P.ltoreq.0.002, stairs 1-12), but not those who receivedplacebo (FIG. 17). This increase was significantly different fromplacebo in the Compound III 1-mg group (P=0.034), but not in theCompound III 3-mg group (P=0.058). A similar trend was observed foreach set of stairs, with significant differences between theCompound III 1-mg and placebo groups for stairs 1-4, stairs 4-8,and stairs 8-12 (P.ltoreq.0.036 for all comparisons). The timerequired to climb all 12 stairs increased slightly from baseline toDay 113/EOS in patients who received placebo, but was significantlydecreased (P.ltoreq.0.008) in both of the Compound III treatmentgroups (FIG. 18). These changes were significantly differentcompared with placebo in the Compound III 1-mg (P=0.007) andCompound III 3-mg (P=0.028) treatment groups.

The percentage changes from baseline to Day 113/EOS in hand gripstrength (both hands) increased in both Compound III treatmentgroups (1 mg, 15.06%; 3 mg, 4.93%). Patients in the placebo groupexperienced a decrease in hand grip strength (-1.07% from baselineto Day 113/EOS). Compared with placebo, there was a significantdifference in the percentage change from baseline in the CompoundIII 1-mg group (P=0.05).

A post hoc analysis demonstrated a significant and clinicallymeaningful improvement in QoL parameters in patients that showed a.gtoreq.1-second improvement in stair climb time compared withpatients who did not show this improvement (P.ltoreq.0.028). Asimilar statistically significant improvement in QoL measurementsfrom baseline to Day 113/EOS was seen in patients who had anincrease in stair climb power of >9.8 watts compared withpatients without this change (P.ltoreq.0.016).

Compound III is well tolerated and safe in patients with cancercachexia and resulted in significant increases in LBM andimprovements in physical function. Importantly, this study providesevidence of clinically meaningful improvements in QoL amongpatients who experienced improvements in physical function (asassessed by stair climb power) with Compound III treatment. The useof Compound III at an earlier stage of disease, possibly as afirst-line treatment, may allow for a greater clinical benefit.

Example 12

Effect of Compound of Formula S-(III) on Physical Function inPatients with Non Small Cell Lung Cancer (NSCLC)

This randomized, double-blind, placebo-controlled, multicenterphase II trial evaluated the efficacy and safety of Compound III, aselective androgen receptor modulator, in cancer patients withmuscle wasting.

Patients and Methods:

Eligible patients were non-obese men aged >45 years orpostmenopausal women with cancer (colorectal, NSCLC, non-Hodgkin'slymphoma, chronic lymphocytic leukaemia and breast cancer) and 22%weight loss in the previous 6 months. Patients (N=159) receivedCompound III 1 mg, 3 mg, or placebo orally once daily for up to 113days. Total LBM was evaluated as the primary endpoint using dualenergy x-ray absorptiometry. The primary endpoint was change inlean body mass measured by dual energy x-ray absorptiometry.Secondary endpoints included QoL and physical function withclinical benefit defined as 10% improvement in physical functionassessed by stair climb power (responder analysis). LBM, physicalfunction and QoL were further assessed in the subset of NSCLCsubjects (N=61).

Results:

Among NSCLC subjects, 28 were included in the physical functionanalysis (MITT). Total LBM and stair climb power increased inCompound III treated subjects compared to baseline (Table 19). LBMimproved by a median of 0.99% from baseline to Day 113/end of studywith Compound III (N=21, MITT; P=0.272) and decreased by 0.83% inplacebo (N=10, MITT). Stair climb power increased by a median15.15% (N=18, MITT; P=0.076) in the Compound III treated subjectscompared to baseline and increased by 1.14% (N=10, MITT) in theplacebo subjects.

Seventy-eight percent of NSCLC patients treated with Compound IIIresponded, as defined by a 10% improvement in stair climb power,compared to 30% treated with placebo (P=0.02). Physical functionwas positively correlated with QoL as assessed by the FunctionalAssessment of Anorexia/Cachexia Therapy (FAACT) questionnairefurther substantiating clinical benefit (Spearman correlationcoefficient=0.60, P=0.001) (FIG. 19).

TABLE-US-00019 TABLE 19 N Treated Obs Variable N Min Median MaxMean Std Dev Pvalue Placebo 12 LBM 10 -5.72 -0.83 4.35 -0.54 2.71stair power_1_12 10 -10.45 1.14 26.80 2.73 12.15 Compound 24 LBM 21-4.84 0.99 6.81 0.37 2.70 0.272 III stair power_1_12 18 -81.5815.15 38.19 8.52 25.79 0.076 1 mg/3 mg

Example 13

Effect of Compound of Formula S-(III) on Overall Survival inPatients with Cancer Cachexia

Subjects (n=159) were randomized to oral Compound of formulaS-(III) (Compound III) (1 or 3 mg) or placebo (pbo) daily for 16weeks. Subjects were males >45 y and postmenopausal females, hadexperienced .gtoreq.2% weight loss in the 6 months prior torandomization, had a body mass index (BMI)<35 and either NSCLC,colorectal cancer, non-Hodgkin's lymphoma, chronic lymphocyticleukemia or breast cancer.

In placebo (pbo) subjects in the intent to treat (ITT) population,overall survival was significantly (P=0.003, log rank) reduced insubjects with >8% weight loss compared to subjects with.ltoreq.8% weight loss. Among NSCLC subjects (n=61) pbo subjectswith >8% weight loss demonstrated a similar survivaldisadvantage (P=0.04); 4 month Kaplan-Meier estimates 100% vs49%.+-.14.8%. In Compound III treated subjects in both the ITT andNSCLC groups, increased weight loss did not negatively affectsurvival.

Preceding weight loss among NSCLC patients not treated withCompound III is predictive of decreased overall survival. In this16 week study, NSCLC subjects randomized to placebo with >8%weight loss at baseline were 2 times more likely to die thansubjects with .ltoreq.8% weight loss. In the Compound III groupweight loss was not predictive of overall survival. These datasuggest that Compound III treatment may overcome the negativeprognostic effect of >8% weight loss.

Example 14

Chemotherapeutic Agents Given in Combination with Compound ofFormula S-(III) for Cancer Cachexia Clinical Trials, DistributionAccording to Chemotherapy Agent Class

TABLE-US-00020 TABLE 20 Distribution of Chemotherapy in Armsaccording to Chemotherapy Agent Class Compound III Placebo TreatedChemo agent Class N = 52 n (%) N = 107 P Value.sup.1 Alkylatingagents 22 (42) 47 (44) 0.87 Antibodies 21 (40) 40 (37) 0.73Antimetabolites 16 (31) 51 (48) 0.06 Kinase Inhibitors 4 (8) 3 (3)0.22 Topo II Inhibitors 10 (19) 22 (21) 0.99 Tubulin Antagonists 13(25) 25 (23) 0.84 .sup.1Exact Pearson's chi-square test Percentagesare rounded to nearest whole percent.

Specific chemotherapeutic agents administered to subjects receivingcompound of formula S-(III) include: bendamustine, bevacizumab,bleomycin, calcium folinate, capecitabine, carboplatin, cetuximab,chlorambucil, cisplatin, cyclophosphamide, cytarabine, docetaxel,doxorubicin, erlotinib, etoposide, fludarabine, fluorouracil,gemcitabine hydrochloride, irinotecan hydrochloride, lapatinib,methotrexate, methylprednisolone acetate, mitoxantrone,mitoxantrone hydrochloride, oxaliplatin, pacl*taxel, panitumumab,pemetrexed, rituximab, trastuzumab, vincristine, andvinorelbine.

Example 15

Combination Treatment of Compound of Formula S-(III) with Platinumand Taxane (Study A) and Combination Treatment of Compound ofFormula S-(III) with Platinum and Non-Taxane (Study B)

Methods

A 3 mg dose of Compound III was studied in two Phase 3 clinicaltrials (Study A and Study B) to prevent and treat muscle wasting inpatients with non-small cell lung cancer (NSCLC). In each of theseplacebo controlled, double blind, add-on clinical trials,approximately 325 patients with stage III or IV NSCLC wererandomized to oral daily doses of placebo or Compound III 3 mg atinitiation of first-line chemotherapy based upon the chemotherapyregimen prescribed; platinum+taxane (Study A, n=321) orplatinum+non-taxane (Study B, n=320). Patients (males andpostmenopausal females 30 y with ECOG 1) received either CompoundIII 3 mg combination therapy or placebo for 5 months. The platinumused was cisplatin or carboplatin. The taxane used was docetaxel orpacl*taxel. The non-taxane used was gemcitabine, pemetrexed orvinorelbine.

Lean body mass (LBM) was measured by dual-energy x-rayabsorptiometry (DXA) and improvement of physical function wasassessed by stair climb power (SCP) at days 84 (primary endpoints)and 147 (secondary endpoints). The stair climb power was measuredaccording to the following equation: Power=9.8m/s.sup.2.times.stair height [m].times.weight [kg]/stair climb time[s].

Secondary endpoints also included an assessment of whether CompoundIII-treated patients had an improved quality of life and reducedhealthcare resource utilization compared to placebo.

Overall survival is being assessed as an additional safetyendpoint.

Table 21 provides the baseline characteristics of Study A(combination treatment of Compound III, platinum and taxane vs. aplacebo of combination of platinum and taxane) and Study B(combination treatment of Compound III, platinum and non-taxane vs.a placebo of platinum and non-taxane).

TABLE-US-00021 TABLE 21 Baseline Characteristics Study A Platinum +Taxane Study B (N = 321) Platinum + Non-Taxane Feature Compound (N= 320) Placebo III Placebo Compound III (n = 161) (n = 160) (n =161) (n = 159) Age (y) 62.0 60.5 62.0 60.0 median (34 to 88) (36 to84) (40 to 81) (41 to 79) (range) Male 71.4% 73.1% 70.2% 71.7% ECOG1 68.3% 68.8% 68.3% 71.1% Stage III 28.0% 28.8% 28.0% 27.0% IV72.0% 71.3% 72.1% 73.0 Chemo regimen Docetaxel 8.7% 9.4% -- --Pacl*taxel 91.3% 90.6% -- -- Gemcitabine -- -- 72.1% 72.3%Pemetrexed -- -- 16.2% 15.7% Vinorelbine -- -- 11.8% 12.0% BaselineLBM (kg/m.sup.2) adjusted for height Female 14.2 14.6 14.8 14.4(11.6 to 19.1) (10.8 to 18.1) (12.7 to 17.5) (11.2 to 18.0) Male17.1 17.6 17.3 17.1 (11.9 to 21.5) (11.7 to 21.6) (13.3 to 24.9)(13.1 to 22.7) Baseline power 158.3 156.5 161.6 164.8 (watts) (25.7to 435.0) (46.7 to 446.8) (65.2 to 458.3) (30.1 to 485.2) >5%weight loss 49.1% 42.5% 51.3% 49.1% prior 6 months Baselinedemographics for Study A and Study B Study A Study B (Platinum +Taxane) (Platinum + Nontaxane) Placebo Cmpd. III Placebo Cmpd. IIIAge (y) 61.9 61.2 62.2 61.0 Male % 71.4 73.1 70.2 71.7 ECOG 1 (%)68.3 68.8 68.3 71.1 >1 mets (%) 37.9 29.4 41.6 42.1 Lung (%)*40.4 37.5 42.9 44.0 Liver (%)* 14.3 9.4 14.3 13.2 Bone (%)* 15.511.9 16.1 19.5 Lymph (%)* 27.3 18.1 33.5 33.3 Brain (%)* 9.3 11.312.4 12.6 >5% loss (%) 49.1 42.5 51.3 49.1 *Referring topercentage of subject with metastases to the respectivetissues.

Results:

Compound III 3 mg once daily had a significant effect on LBMthrough Day 84 to and 147 in both studies:

Study A: p=0.0003 (day 84) and <0.0001 (day 147), as presentedin Table 22B and FIGS. 20A-20B;

Study B: p=0.0227 (day 84) and 0.0036 (day 147), as presented inTable 23B and FIGS. 23A-23B, using continuous variableanalyses.

By the responder* analysis, a larger proportion of patientsreceiving Compound III maintained or increased LBM at Day 84 and147 in both studies (Study A: p=0.036 (Table 22A) and 0.026 (Table22C); Study B: p=0.113 (Table 23A) and 0.013 (Table 23C)), ascompared to placebo.

*Responder in this case defined as a subject that maintained ordemonstrated an increase in LBM at Day 84 as compared to baselineand that demonstrated a 10% or greater increase in stair climbpower [watts] at Day 84 as compared to baseline.

A non-responder is a subject who does not meet the definition ofresponse or does not have the Day 84 assessment. Variations on theresponder analyses are presented in

Results of Study a (Combination Treatment of Compound III, Platinumand Taxane)

TABLE-US-00022 TABLE 22A Responder Analyses % Responders (n)Compound III Placebo (N = 161) (N = 160) p-value LBM Day 84 30.4%(49) 41.9% (67) 0.036 SCP Day 84 24.2% (39) 29.4% (47) 0.315

TABLE-US-00023 TABLE 22B Mixed-effect Model Repeated Measure (MMRM)Analyses MMRM Slopes Statistical hierarchy Placebo Compound IIIp-value 1 SCP Day 84 -0.0639 +0.0522 0.0185 2 LBM Day 84 -9.8357+4.5459 0.0003 3 SCP Day 147 -0.0652 -0.0166 0.0486 4 LBM Day 147-9.6908 +1.2782 <0.0001

TABLE-US-00024 TABLE 22C Results for 5% and 10% increase in stairclimb power % Responders (n) Placebo Compound III Statisticalhierarchy N = 161 N = 160 p-value 5 SCP 5% Day 84 32.3% (52) 36.3(58) 0.407 6 SCP 10% Day 147 18.0% (29) 20.6% (33) 0.671 7 LBM Day147 23.5% (38) 35.0% (56) 0.026

Compound III treated patients in Study A achieved the primaryendpoint in SCP through Day 84 (p=0.0185) and the secondaryendpoint of SCP through Day 147 (p=0.0486) (Table 22B above andFIGS. 22A-22B).

The effect on LBM in Study A was achieved despite declining of bodyweight (FIG. 21A-21B).

TABLE-US-00025 TABLE 22D Percentage of subjects (of Study A) whohad a day 84 and a day 147 response Stair Climb Power (%Responders) Placebo 43.6% (n = 17) Compound 57.4% (n = 27) III LeanBody Mass (% Responders) Placebo 55.1% (n = 27) Compound 67.2% (n =45) III

TABLE-US-00026 TABLE 22E Percentage in which LBM was maintained orincreased and SCP was .gtoreq.10% increased (Study A) % ResponderDay 84 Day 147 Placebo 10.6 6.8 Compound 19.4 12.5 III p value0.029 0.09

TABLE-US-00027 TABLE 22F Percentage in which LBM was maintained orincreased and SCP was maintained or increased (Study A) %Responders Day 84 Day 147 Placebo 16.2 13.7 Compound 30.0 20.0 IIIp value 0.004 0.1624

Results of Study B (Combination Treatment of Compound III, Platinumand Non-Taxane) Efficacy Endpoints

TABLE-US-00028 TABLE 23A Responders analyses % Responders (n)Placebo Compound III p- (N = 161) (N = 159) value LBM Day 84 37.9%(61) 46.5% (74) 0.113 SCP Day 84 24.8% (40) 19.5% (31) 0.289

TABLE-US-00029 TABLE 23B MMRM analyses MMRM slopes Statisticalhierarchy Placebo Compound III p-value 1 SCP Day 84 -0.0146 -0.02630.7923 2 LBM Day 84 -5.5577 +4.0065 0.0227 3 SCP Day 147 -0.0050+0.0072 0.6669 4 LBM Day 147 -5.2270 +2.1192 0.0036

TABLE-US-00030 TABLE 23C % Responders (n) Placebo Compound IIIStatistical hierarchy N = 161 N = 159 p-value 5 SCP 5% Day 84 33.5%(54) 23.9% (38) 0.054 6 SCP 10% Day 147 21.1% (34) 18.9% (30) 0.6797 LBM Day 147 27.9% (45) 40.9% (65) 0.013

TABLE-US-00031 TABLE 23D Percentage of subjects who had a day 84and a day 147 response Stair Climb Power (% Responders) Placebo57.5% (n = 23) Compound III 51.6% (n = 16) Lean Body Mass (%Responders) Placebo 62.3% (n = 38) Compound III 73.0% (n = 54)

TABLE-US-00032 TABLE 23E Percentage in which LBM was maintained orincreased and SCP: .gtoreq.10% increase (Study B) % Responders Day84 Day 147 Placebo 14.9 9.3 Compound III 15.1 15.1 p value 0.990.126

TABLE-US-00033 TABLE 23F Percentage in which LBM was maintained orincreased and SCP was maintained or increased (Study B) %Responders Day 84 Day 147 Placebo 24.2 16.8 Compound III 23.3 22.6p value 0.939 0.2325

The effect on LBM in Study B was achieved despite declining of bodyweight (FIGS. 24A-24B).

In a post-hoc analysis, regardless of treatment, patients with a.gtoreq.1 kg increase in LBM were more likely to demonstrate atleast a 10% increase in SCP compared to patients who did not have a.gtoreq.1 kg increase in LBM (Study A: 43.7% vs 29.3%, p=0.0250;and Study B: 40.5% vs 26.5%, p=0.0321) (FIGS. 35 and 36). Thepercentage improvement in SCP from baseline to day 84 differedsignificantly between patients with and without a 1 kg increase inLBM: 9.1% vs -1.0% in Study A (p=0.0022) and 7.7% vs -0.0.6% inStudy B (p=0.0046).

Importantly, a larger proportion of Compound III treated patients,with 1 kg or greater increases in LBM, demonstrated at least a 10%increase in SCP (Study A: p=0.0698, .gtoreq.1 kg 46.4%, <1 kg29.6%; and Study B: p=0.0335, .gtoreq.1 kg 39.6%, <1 kg 20.4%),while this same trend was not observed in placebo treated patients(Study A: p=0.3149, .gtoreq.1 kg 38.7%, <1 kg 29.0%; and StudyB: p=0.2852, .gtoreq.1 kg 41.5%, <1 kg 31.3%) (FIG. 36). Thisobservation suggests that SCP improvements, in both trials, may berelated to Compound III dependent increases in LBM.

Post-hoc landmark survival analyses at Day 84 suggest improvedsurvival in patients who maintained or increased LBM in bothclinical trials, regardless of treatment. (FIG. 31). Publishedstudies have reported that loss of muscle is associated withshorter survival in cancer patients. Studies A and B support theseprimarily retrospective analyses with a prospective assessment ofthe relationship between LBM and overall survival in advanced lungcancer patients (FIGS. 32-34).

Summary and Conclusions

TABLE-US-00034 TABLE 24 Summary of adequate, well controlledclinical studies for Compound III for the prevention and treatmentof muscle wasting in patients with advanced NSCLC. Study (Duration)Results from Study disclosed in Phase 3 Study A Phase 3 Study BExamples 11 and 12 hereinabove (20 weeks) (20 weeks) (16 weeks)Placebo 3 mg Placebo 3 mg Placebo 1 mg 3 mg (Day 84) (Day 84) (Day84) (Day 84) LBM 0.02 kg 1.5 kg 1.0 kg -9.8357 +4.5459 -5.5577+4.0065 change slope slope slope slope (Muscle) SCP +4.8% +18.0%+21.7% -0.0639 +0.0522 -0.0146 -0.0263 change slope slope slopeslope (Function) Safety + + + + Survival N/A 0.80 0.70 0.54* 0.38*0.6* 0.37* (HR) Population NSCLC, colorectal, NSCLC NSCLC typeNonHodgkins, CLL, Breast Chemo controlled: Chemo controlled:cancers- Platinum + Taxane Platinum + Nontaxane Chemo notcontrolled: N 159 321 320

NSCLC patients on first line platinum doublet chemotherapy haveaccelerated muscle loss and physical function decline in abackground of progressive weight loss. Compound III maintained orimproved muscle mass while subjects on chemotherapy alone continuedto lose muscle mass over a relatively short period of time (3months). Compound III stopped the physical function decline whilesubjects on chemotherapy alone continued to decline in physicalfunction. Prevention and treatment of muscle loss was demonstratedin both Study A and Study B clinical trials.

Lean body mass was observed to be an important prognostic indicatorfor increased survival in both chemotherapy and chemotherapy plusCompound III NSCLC patients. Compound III maintained and builtmuscle better than chemotherapy alone.

In Study A and Study B, declines in both lean body mass and stairclimb power were observed in placebo group.

Statistically and clinically meaningful differences betweenCompound III (Study A) and placebo were observed for both lean bodymass (muscle) and stair climb test (physical function).

Statistically and clinically meaningful differences betweenCompound III (Study B) and placebo were observed for lean body mass(muscle).

The effect on LBM in Study A and Study B was achieved despitedeclining body weights (FIGS. 21A-21B and 24A-24B).

Different populations and chemotherapy side effects (anemia &vomiting (See Example 16)) in Study B appear to explain physicalfunction responses. Evidence suggests longer duration of therapy orincreasing Compound III dose may overcome these side effects ofchemotherapy

Compound III was very well tolerated in both Study A and Study B.In general, patients that maintained or increased LBM had greaterincreases in SCP and survived longer.

Example 16

Adverse Events of Study A and Study B

Table 24 provides treatment emergent adverse events of subjectstreated with the combination of Compound III, platinum and taxane(Study A) and subjects treated with Compound III, platinum andnon-taxane (Study B).

Based on the results, adverse events were observed in .gtoreq.5%subjects with a difference of .gtoreq.22% between placebo andCompound III.

TABLE-US-00035 TABLE 25 Differences in selected AEs between theStudies STUDY A STUDY B (Platinum + (Platnium + Taxane) Nontaxane)Adverse Event Placebo Cmpd III Placebo Cmpd III Anemia 27.3% 28.8%47.9% 50.9% Neutropenia 18.6% 12.5% 33.9% 30.9% Leukopenia 3.1%3.8% 17.0% 15.8% Thrombocytopenia 5.6% 3.8% 17.6% 18.8% Nausea32.3% 35.6% 44.2% 44.8% Vomiting 16.1% 18.1% 29.1% 27.3%Constipation 8.6% 10.6% 15.2% 12.7% Asthenia 12.4% 20.6% 16.4%15.2% Decreased appetite 16.8% 6.9% 17.0% 19.4% Arthralgia 13.7%16.9% 2.4% 1.8% Alopecia 32.3% 33.8% 10.3% 10.9% Diarrhoea 14.9%11.3% Dyspnoea 7.5% 13.1% 6.7% 12.7% Peripheral Sensory 5.6% 11.9%Neuropathy Pneumonia 8.7% 5.0% Haemoptysis 8.7% 4.4% 6.7% 3.6% Painin Extremity 5.6% 8.1% Chest pain 7.3% 3.6% Cough 9.1% 11.5%Hypokalemia 7.3% 3.0% Blood creatinine 9.1% 13.9% increased

The non responders also had adverse effects as demonstrated inFIGS. 26 and 27.

FIG. 26 demonstrates that the plasma concentrations of Compound IIIwere lower in Study B LBM nonresponders. FIG. 27 (left panel)demonstrates that LBM nonresponders who reported nausea andvomiting had lower Compound III levels in Study B. FIG. 27 (rightpanel) demonstrates that Compound III levels were similar in LBMresponders and non-responders who did not report nausea andvomiting.

Only minor differences in adverse events were observed between thegroups treated with Compound III 3 mg and placebo in the Study Aand Study B, however, there were notable differences in the adverseevent profile between studies with anemia and other hematologictoxicities more prevalent in the Study B (platinum plus non-taxane)clinical trial.

Example 17

Hemoglobin Concentrations Following Study A and Study B

FIG. 28 shows that Study B (platinum+nontaxane) subjects had lowerhemoglobin levels. However, the hemoglobin levels did not affectLBM response (Table 26 and FIG. 29). Current understanding of theability of Compound III to build or maintain LBM is not thought torely on sufficient hemoglobin for muscle oxygenation andrespiration.

TABLE-US-00036 TABLE 26 Responders analyses: Lean Body Mass (LBM)maintain or increase Hemoglobin (g/dL), median (range)Nonresponders Responders Study A (n = 132) (n = 116) p-value Day 8411.80 (7.10-20.80) 11.90 (8.5-15.80) 0.2587 Hemoglobin (g/dL),median (range) Nonresponders Responders Study B (n = 90) (n = 134)p-value Day 84 10.50 (7.00-15.50) 10.70 (7.70-14.60) 0.7845

However, hemoglobin levels were related to the ability of LBMresponders to have a stair climb test benefit (Table 27 and FIG.30). Anemia, manifest in this case as a reduction in hemoglobin, isa well-established cause of weakness, fatigue, deconditioning, andloss of physical function which could influence the results of afunctional endpoint such as SCP in response to maintained orincreased LBM. The overall lower hemoglobin levels in Study Brelative to Study A suggest that LBM responders in Study B may havelacked sufficient hemoglobin to translate drug mediated LBM effectsinto SCP performance.

TABLE-US-00037 TABLE 27 Responders analyses: Stair Climb Power(SCP) .gtoreq.10% increase Hemoglobin (g/dL), median (range)Nonresponders Responders Study A (n = 174) (n = 86) p-value Day 8411.60 (7.10-20.80) 12.30 (9.20-15.80) 0.0152 Hemoglobin (g/dL),median (range) Nonresponders Responders Study B (n = 158) (n = 71)p-value Day 84 10.60 (7.00-15.50) 10.50 (7.70-14.60) 0.8250

Example 18

Studies of Compound of Formula S-(III) on Knockout Mice

Dystrophin (DMD) hom*ozygous null nice (-/-) and utrophin (UTRN)heterozygous mice (+/-) were obtained from JAX labs. The animalswere used to breed DMD (-/-) UTRN (+/+) and DMD (-/-) UTRN (-/-)mice.

When mice attained 4-6 weeks of age, male mice were castrated andtreated as indicated in Table 28.

TABLE-US-00038 TABLE 28 Study Design Group No. Mice TreatmentDuration N 1 DMD (-/-) UTRN (-/-) Vehicle 12 weeks 8 2 DMD (-/-)UTRN (-/-) 10 mg/kg/day S-(III) 12 weeks 8 3 DMD (-/-) UTRN (-/-)10 mg/kg/day S-(V) 12 weeks 8 4 DMD (-/-) UTRN (-/-) 10 mg/kg/dayS-(IV) 12 weeks 8 5 Wildtype Vehicle 12 weeks 8 6 Wildtype 10mg/kg/day S-(III) 12 weeks 8 7 Wildtype 10 mg/kg/day S-(V) 12 weeks8 8 Wildtype 10 mg/kg/day S-(IV) 12 weeks 8 9 DMD (-/-) UTRN (-/-)Vehicle till death (~20 weeks) 8 10 DMD (-/-) UTRN (-/-) 10mg/kg/day S-(III) till death (~20 weeks) 8 11 DMD (-/-) UTRN (-/-)10 mg/kg/day S-(V) till death (~20 weeks) 8 12 DMD (-/-) UTRN (-/-)10 mg/kg/day S-(IV) till death (~20 weeks) 8 13 DMD (-/-) UTRN(+/+) Vehicle 12 weeks 8 14 DMD (-/-) UTRN (+/+) 10 mg/kg/dayS-(III) 12 weeks 8 15 DMD (-/-) UTRN (+/+) 10 mg/kg/day S-(V) 12weeks 8 16 DMD (-/-) UTRN (+/+) 10 mg/kg/day S-(IV) 12 weeks 8

Compounds of formulas S-(III), S-(VI), and S-(V) were used at 10 mgper kg per day subcutaneously (mpk/day s.c.). Compound of formulaS-(III) is the S-isomer of Compound III or(S)--N-(4-cyano-3-(trifluoromethyl)phenyl)-3-(4-cyanophenoxy)-2-hydroxy-2--methylpropanamide. Compound of formula S-(IV) is(S)--N-(3-chloro-4-cyano-phenyl)-3-(4-cyanophenoxy)-2-hydroxy-2-methylpro-panamide. Compound of formula S-(V) is(S)--N-(4-cyano-3-(trifluoromethyl)phenyl)-3-(4-cyano-3-fluorophenoxy)-2--hydroxy-2-methylpropanamide. In FIGS. 38A-38C, `SARMs` iscumulative data across groups 2, 3, and 4. In FIG. 39A, thelabeling as `SARM` indicates cumulative data across groups 2 and 4.One set of UTRN wildtype mice (i.e., the mdx model or DMD (-/-)UTRN (+/+) mice) were also used (i.e., groups 13-16) to evaluatethe effect of S-(III) (and other SARMs) on duch*enne musculardystrophy through UTRN up-regulation.

Weekly body weight, MRI measurements, and grip strengths weremeasured (body weight: biweekly; MRI scan: once every 2 weeks oronce every week; and grip strength: Once every 2 weeks or onceevery week).

Groups 1-8 and 13-16 were sacrificed after 12 weeks of treatmentand various tissues were excised, weighed, and stored appropriatelyfor further analysis. At sacrifice, blood was collected for serumbiochemical markers (ALT, AST, glucose, cholesterol creatinine,creatine kinase, pyruvate, and others). Echocardiogram wasperformed in one set of knockout mice. As inflammation isconsidered as one of the primary pathogenic mechanisms, a seruminflammatory marker panel was evaluated. Organs (prostate, seminalvesicles, levator ani, soleus, gastrocnemious, heart, lungs, andliver) were weighed and stored for gene expression studies andhistology. Levator ani, soleus, extensor digitorum longus (EDL),and gastrocnemious muscles were processed to measure the tension(if possible), histology and gene expression.

FIGS. 37A-37D show that DMD (-/-) UTRN (+/+) mice when treated withS-(III) demonstrated a significant increase in body weight (FIG.37A), lean [muscle] mass (FIG. 37C), and grip strength (FIG. 37D),and also a decrease in fat mass (FIG. 37B).

FIGS. 38A-38C show that double knock out mice (DMD (-/-) UTRN(-/-)) when treated with vehicle significantly and rapidly losttheir body weight, lean [muscle] mass, and grip strength. However,`SARMs` (S-(III), S-(VI), and S-(V); data shown is cumulativeacross groups 1-4) delayed the deterioration of these measurementssignificantly. Further, `SARMs` enhanced the ability of these miceto be ambulatory.

DMD (-/-) UTRN (-/-) male mice were castrated and treated withvehicle or a compound of this invention at 10 mpk s.c. The numberof weeks the mice survived was recorded and expressed. The `SARM`treated group combines the data for S-(III) and S-(V) treatedanimals together. Animals from the same litter are shown in FIG.39B. FIGS. 39A (cumulative data for S-(III) and S-(V) and 39B(S-(III)) show that due to enhancement in body weight and lean[muscle] mass, the [castrated] DMD (-/-) UTRN (-/-) mice treatedwith the indicated compounds of the invention lived longer byapproximately 40-50% compared to [castrated] vehicle-treatedcontrol mice from the same litter, suggesting the result is not dueto genetic variation but drug efficacy. Cumulatively, this suggeststhat patients with duch*enne muscular dystrophy treated with S-(III)(or another SARM of this invention) are expected to not onlybenefit from improved growth and strength (e.g., improved physicalfunction and quality of life such as longer ambulation) but alsomay live longer lives. A possible explanation for the survivalbenefit may be due, in part, to improved cardiac function.

FIGS. 40A and 40B and FIGS. 41A and 41B show that intact andcastrated mdx mice, i.e., DMD (-/-) UTRN (+1+), were both effectedby S-(III) treatment. The effects of S-(III) reported above forcastrated mdx mice were also seen in intact mdx mice. E.g., S-(III)increased body weight (FIGS. 40A-40B) and lean mass (FIGS. 41A-41B)in castrated and intact mdx mice. This suggests that thetherapeutic effects for duch*enne muscular dystrophy were not anartifact of the use of castrated animals to model the disease.

It will be appreciated by a person skilled in the art that thepresent invention is not limited by what has been particularlyshown and described hereinabove. Rather, the scope of the inventionis defined by the claims that follow.

SEQUENCE LISTINGS

1

23121DNAArtificial SequenceMSX-1 Forward Primer 1aacccagccacagactaaag a 21220DNAArtificial SequenceMSX-1 Reverse Primer2tcccttgttc tcgttccttc 20324DNAArtificial SequenceMSX-1 TaqManProbe 3aaagaggagc ggaaaagagg gctg 24420DNAArtificial SequenceAPIG1Forward Primer 4gggtccgagt tcttggataa 20520DNAArtificialSequenceAPIG1 reverse Primer 5atcctgagga aggagggagt20624DNAArtificial SequenceAPIG1 TaqMan Probe 6ggacagggagcgaagtttcc tcaa 24719DNAArtificial SequenceAXIN-1 Forward Primer7attccaagga cctgcaacg 19818DNAArtificial SequenceAXIN-1 ReversePrimer 8gagagggcgt ggtcagtg 18920DNAArtificial SequenceAXIN-1TaqMan Probe 9cgcctctccc actccgctct 201020DNAArtificialSequenceBATF-1 Forward Primer 10ctggacttaa ggggtgagga201120DNAArtificial SequenceBATF-1 Reverse Primer 11ggagaggacaaccaggaaaa 201222DNAArtificial SequenceBATF-1 TaqMan Probe12tgagcagctg ctttcggctg aa 221320DNAArtificial SequenceSHC-1Forward Primer 13taactcggga aagtgggaag 201420DNAArtificialSequenceSHC-1 Reverse Primer 14agcttaggtt accgctccaa201526DNAArtificial SequenceSHC-1 TaqMan Probe 15aataaagtttctccagggag gcaggg 261632DNAArtificial SequenceNFkB1 Forward Primer16ctcgagagag tatggaccgc atgactctat ca 321732DNAArtificialSequenceNFkB1 Reverse Primer 17acgcgtagag agagcataca gacagacgga ca321820DNAArtificial SequencePCBP2 Forward Primer 18agatgatgggaggtttggag 201920DNAArtificial SequencePCBP2 Reverse Primer19gcctaaacca gaaaccaagg 202026DNAArtificial SequencePCBP2 TaqManProbe 20atttggggta agggaggtga aggagg 262125DNAArtificialSequencePSA Forward Primer 21gcctggatct gagagagata tcatc252225DNAArtificial SequencePSA Reverse Primer 22acacctttttttttctggat tgttg 252328DNAArtificial SequencePSA TaqMan Probe23tgcaaggatg cctgctttac aaacatcc 28

* * * * *